Result : EXP03734
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03734 |
| NCBI Accession ID | |
| Organism | Bacteroides,Paraprevotella,Odoribacter |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGAATATTACTACTCTAAATAACCTGGCAGTCCTGCATATTATTCGCGTCGTGGTGGTGGTCACACTGGGAGCGTGA |
| Sequence | MNITTLNNLAVLHIIRVVVVVTLGA |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3615412 | 3615486 | + | NZ_LR699004.1 | Phocaeicola dorei |
| 2 | 3259196 | 3259270 | + | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 3 | 1443004 | 1443078 | + | NZ_CP027234.1 | Bacteroides heparinolyticus |
| 4 | 1003245 | 1003319 | - | NZ_CP027231.1 | Bacteroides zoogleoformans |
| 5 | 3961341 | 3961415 | - | NC_014933.1 | Bacteroides helcogenes P 36-108 |
| 6 | 906930 | 907010 | + | NZ_CP069440.1 | Phocaeicola coprophilus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR699004.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00920.23 | 1.0 | 6 | 97.0 | same-strand | Dehydratase family |
| 2 | PF02776.20 | 1.0 | 6 | 1987.5 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 3 | PF02775.23 | 1.0 | 6 | 1987.5 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 4 | PF00205.24 | 1.0 | 6 | 1987.5 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 5 | PF10369.11 | 1.0 | 6 | 3728.0 | same-strand | Small subunit of acetolactate synthase |
| 6 | PF01842.27 | 1.0 | 6 | 3728.0 | same-strand | ACT domain |
| 7 | PF13710.8 | 1.0 | 6 | 3728.0 | same-strand | ACT domain |
| 8 | PF01643.19 | 1.0 | 6 | 4284.5 | same-strand | Acyl-ACP thioesterase |
| 9 | PF07991.14 | 0.83 | 5 | 5091 | same-strand | Acetohydroxy acid isomeroreductase, NADPH-binding domain |
| 10 | PF01450.21 | 0.83 | 5 | 5091 | same-strand | Acetohydroxy acid isomeroreductase, catalytic domain |
++ More..