Result : EXP03725
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03725 |
| NCBI Accession ID | |
| Organism | Bacteroides |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGCTTCCCCGCATTTGTTTATTACATGCAAATCGGCCTGACGCTGCTTATGTATATGTGAATATCCGTAATTAG |
| Sequence | MLPRICLLHANRPDAAYVYVNIRN |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 59228 | 59290 | - | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 2 | 29943 | 30005 | - | NC_014652.1 | Caldicellulosiruptor hydrothermalis 108 |
| 3 | 64906 | 64968 | - | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_014720.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09515.12 | 0.67 | 2 | 4015.0 | same-strand | Thiamine transporter protein (Thia YuaJ) |
| 2 | PF00709.23 | 1.0 | 3 | 2580 | opposite-strand | Adenylosuccinate synthetase |
| 3 | PF00664.25 | 1.0 | 3 | 305.0 | opposite-strand | ABC transporter transmembrane region |
| 4 | PF00005.29 | 1.0 | 3 | 672 | opposite-strand | ABC transporter |
| 5 | PF02463.21 | 1.0 | 3 | 673 | opposite-strand | RecF/RecN/SMC N terminal domain |
| 6 | PF01944.19 | 1.0 | 3 | 1538 | same-strand | Stage II sporulation protein M |
| 7 | PF13483.8 | 1.0 | 3 | 2287 | opposite-strand | Beta-lactamase superfamily domain |
| 8 | PF04932.17 | 1.0 | 3 | 3571.5 | opposite-strand | O-Antigen ligase |
| 9 | PF13181.8 | 1.0 | 3 | 2935 | opposite-strand | Tetratricopeptide repeat |
| 10 | PF13439.8 | 0.67 | 2 | 5822.0 | opposite-strand | Glycosyltransferase Family 4 |
++ More..