Result : EXP03710
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03710 |
| NCBI Accession ID | |
| Organism | Aerococcus |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGGAATTATCAGATATTCATCATCAATTAGAAACTTATCAAGAAAAAATTGCTAGTTTCGGGAGGTCTCTTTGA |
| Sequence | MELSDIHHQLETYQEKIASFGRSL |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 25
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 489155 | 489229 | - | NZ_CP014159.1 | Aerococcus christensenii |
| 2 | 435920 | 435994 | + | NZ_CP053421.1 | Pediococcus acidilactici |
| 3 | 962257 | 962331 | - | NZ_CP049889.1 | Jeotgalibaca porci |
| 4 | 13433 | 13507 | + | NZ_CP019728.1 | Jeotgalibaca dankookensis |
| 5 | 806022 | 806096 | + | NZ_CP016843.1 | Carnobacterium divergens |
| 6 | 2217257 | 2217331 | + | NZ_CP014912.1 | Secundilactobacillus paracollinoides |
| 7 | 2299806 | 2299880 | + | NZ_AP019711.1 | Amedibacterium intestinale |
| 8 | 432662 | 432736 | + | NZ_CP045530.1 | Limosilactobacillus pontis |
| 9 | 1049278 | 1049352 | - | NZ_LR134275.1 | Streptococcus vestibularis |
| 10 | 1101493 | 1101567 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 11 | 480873 | 480947 | + | NC_008525.1 | Pediococcus pentosaceus ATCC 25745 |
| 12 | 424439 | 424513 | + | NZ_CP044534.1 | Limosilactobacillus frumenti |
| 13 | 863276 | 863350 | + | NZ_CP065211.1 | Enterococcus lactis |
| 14 | 784634 | 784708 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 15 | 1679865 | 1679939 | - | NZ_AP014680.1 | Paucilactobacillus hokkaidonensis JCM 18461 |
| 16 | 236595 | 236669 | + | NZ_CP014161.1 | Aerococcus urinae |
| 17 | 33662 | 33736 | - | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 18 | 2215383 | 2215457 | - | NZ_CP059540.1 | Planococcus maritimus |
| 19 | 2193324 | 2193398 | - | NZ_CP016538.2 | Planococcus maritimus |
| 20 | 1373465 | 1373539 | + | NZ_CP049740.1 | Jeotgalibaca arthritidis |
| 21 | 2543274 | 2543348 | - | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 22 | 1459409 | 1459483 | + | NZ_CP023011.2 | Enterococcus hirae |
| 23 | 1990807 | 1990881 | - | NZ_CP013659.2 | Planococcus rifietoensis |
| 24 | 2436900 | 2436974 | - | NZ_CP016537.2 | Planococcus halocryophilus |
| 25 | 2173131 | 2173205 | - | NZ_CP016539.2 | Planococcus plakortidis |
| 26 | 1474277 | 1474351 | - | NZ_CP012047.1 | Tetragenococcus halophilus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP016843.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03462.20 | 1.0 | 25 | 44.0 | same-strand | PCRF domain |
| 2 | PF00472.22 | 1.0 | 25 | 44.0 | same-strand | RF-1 domain |
| 3 | PF07517.16 | 0.92 | 23 | 79.5 | same-strand | SecA DEAD-like domain |
| 4 | PF07516.15 | 0.92 | 23 | 79.5 | same-strand | SecA Wing and Scaffold domain |
| 5 | PF01043.22 | 0.92 | 23 | 79.5 | same-strand | SecA preprotein cross-linking domain |
| 6 | PF02482.21 | 0.84 | 21 | 2879.5 | same-strand | Sigma 54 modulation protein / S30EA ribosomal protein |
| 7 | PF16321.7 | 0.84 | 21 | 2879.5 | same-strand | Sigma 54 modulation/S30EA ribosomal protein C terminus |
| 8 | PF00271.33 | 0.88 | 22 | 4236 | same-strand | Helicase conserved C-terminal domain |
| 9 | PF04851.17 | 0.8 | 20 | 4265 | same-strand | Type III restriction enzyme, res subunit |
| 10 | PF00270.31 | 0.6 | 15 | 4271.5 | same-strand | DEAD/DEAH box helicase |
| 11 | PF00005.29 | 0.68 | 17 | 1248 | same-strand | ABC transporter |
++ More..