Result : EXP03683
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03683 |
| NCBI Accession ID | |
| Organism | Bacteroides,Parabacteroides,Paraprevotella,Odoribacter,Alistipes |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGAAAAGAGTAAAAAGTTTTTTCAAAGGATATATGAGGGCTATTGAAATTAATGCCGCATTAATGTATGGTTATAGACCTAAATAA |
| Sequence | MKRVKSFFKGYMRAIEINAALMYGYRPK |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 496539 | 496625 | + | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 2 | 553912 | 553998 | + | NZ_LR699004.1 | Phocaeicola dorei |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_009614.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01979.22 | 1.0 | 2 | 3203.5 | same-strand | Amidohydrolase family |
| 2 | PF04961.14 | 1.0 | 2 | 2559.5 | same-strand | Formiminotransferase-cyclodeaminase |
| 3 | PF00221.21 | 1.0 | 2 | 1028.5 | same-strand | Aromatic amino acid lyase |
| 4 | PF00293.30 | 1.0 | 2 | 410.0 | same-strand | NUDIX domain |
| 5 | PF01408.24 | 1.0 | 2 | 2327.0 | same-strand | Oxidoreductase family, NAD-binding Rossmann fold |
++ More..