Result : EXP03669
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03669 |
| NCBI Accession ID | |
| Organism | Bacteroides |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGCAGATAAAAGCAGATGTTAAGTCTGTACTAGTTTGTATTAATCTGCGTTTCTTTTTCTATATTAATGAACTGTTTTACGGATAA |
| Sequence | MQIKADVKSVLVCINLRFFFYINELFYG |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3312887 | 3312982 | - | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 2 | 1089413 | 1089505 | - | NZ_CP015401.2 | Bacteroides caecimuris |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP040530.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01571.23 | 1.0 | 2 | 4127.0 | opposite-strand | Aminomethyltransferase folate-binding domain |
| 2 | PF08669.13 | 1.0 | 2 | 4127.0 | opposite-strand | Glycine cleavage T-protein C-terminal barrel domain |
| 3 | PF00999.23 | 1.0 | 2 | 1702.5 | opposite-strand | Sodium/hydrogen exchanger family |
| 4 | PF02080.23 | 1.0 | 2 | 1702.5 | opposite-strand | TrkA-C domain |
| 5 | PF01230.25 | 1.0 | 2 | 1227.5 | opposite-strand | HIT domain |
| 6 | PF01479.27 | 1.0 | 2 | 671.5 | same-strand | S4 domain |
| 7 | PF01195.21 | 1.0 | 2 | -3.0 | same-strand | Peptidyl-tRNA hydrolase |
| 8 | PF01386.21 | 1.0 | 2 | 44.0 | same-strand | Ribosomal L25p family |
| 9 | PF14693.8 | 1.0 | 2 | 44.0 | same-strand | Ribosomal protein TL5, C-terminal domain |
| 10 | PF11680.10 | 1.0 | 2 | 770.5 | same-strand | Protein of unknown function (DUF3276) |
| 11 | PF02699.17 | 1.0 | 2 | 2308.5 | opposite-strand | Preprotein translocase subunit |
++ More..