Result : EXP03668
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03668 |
| NCBI Accession ID | |
| Organism | |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGCACGTGGTAGAAGAGCGTTGTATGAGGAGCGAAGCGAAAATGAAAATGATCGTGGACTTCATACAAGTGACCATGCAAGCATGA |
| Sequence | MHVVEERCMRSEAKMKMIVDFIQVTMQA |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 905932 | 906012 | + | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 2 | 436917 | 436997 | - | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 3 | 1527108 | 1527188 | + | NZ_AP021898.1 | Akkermansia muciniphila |
| 4 | 1006561 | 1006641 | - | NZ_AP021898.1 | Akkermansia muciniphila |
| 5 | 330371 | 330451 | - | NZ_AP021898.1 | Akkermansia muciniphila |
| 6 | 14779 | 14859 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 7 | 51577 | 51657 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 8 | 94242 | 94322 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 9 | 191237 | 191317 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 10 | 198340 | 198420 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 11 | 1863399 | 1863479 | - | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 12 | 1790211 | 1790291 | - | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 13 | 180498 | 180578 | + | NZ_CP066014.1 | Anaerococcus vaginalis |
| 14 | 1370362 | 1370442 | - | NZ_CP066014.1 | Anaerococcus vaginalis |
| 15 | 1891006 | 1891086 | + | NZ_CP066014.1 | Anaerococcus vaginalis |
| 16 | 612520 | 612600 | + | NZ_CP067016.1 | Anaerococcus obesiensis |
| 17 | 795914 | 795994 | + | NZ_CP067016.1 | Anaerococcus obesiensis |
| 18 | 92092 | 92172 | - | NZ_CP067016.1 | Anaerococcus obesiensis |
| 19 | 1343288 | 1343368 | - | NZ_CP009761.1 | Parvimonas micra |
| 20 | 140170 | 140250 | + | NZ_CP009761.1 | Parvimonas micra |
| 21 | 560048 | 560128 | + | NZ_CP009761.1 | Parvimonas micra |
| 22 | 218267 | 218353 | + | NZ_CP033433.1 | Cohnella candidum |
| 23 | 654123 | 654209 | + | NZ_CP033433.1 | Cohnella candidum |
| 24 | 659475 | 659570 | + | NZ_CP033433.1 | Cohnella candidum |
| 25 | 3684183 | 3684269 | - | NZ_CP033433.1 | Cohnella candidum |
| 26 | 3607751 | 3607837 | - | NZ_CP033433.1 | Cohnella candidum |
| 27 | 2600732 | 2600827 | - | NZ_CP033433.1 | Cohnella candidum |
| 28 | 4257784 | 4257870 | + | NZ_CP033433.1 | Cohnella candidum |
| 29 | 4330546 | 4330641 | + | NZ_CP033433.1 | Cohnella candidum |
| 30 | 4428877 | 4428963 | + | NZ_CP033433.1 | Cohnella candidum |
++ More..