Result : EXP03656
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03656 |
| NCBI Accession ID | |
| Organism | Bacteroides |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGTCTAATTTATATTTGAAAAATACGCACTTATATTATACATATTGGAATATTATTCGTATCTTTGTCGCCCGATTTATATAG |
| Sequence | MSNLYLKNTHLYYTYWNIIRIFVARFI |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 692426 | 692509 | - | NZ_LR699004.1 | Phocaeicola dorei |
| 2 | 643785 | 643868 | - | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR699004.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01926.25 | 1.0 | 2 | 2426.5 | same-strand | 50S ribosome-binding GTPase |
| 2 | PF02421.20 | 1.0 | 2 | 2426.5 | same-strand | Ferrous iron transport protein B |
| 3 | PF14714.8 | 1.0 | 2 | 2884.5 | same-strand | KH-domain-like of EngA bacterial GTPase enzymes, C-terminal |
| 4 | PF10662.11 | 1.0 | 2 | 2426.5 | same-strand | Ethanolamine utilisation - propanediol utilisation |
| 5 | PF07650.19 | 1.0 | 2 | 1969.0 | same-strand | KH domain |
| 6 | PF00071.24 | 1.0 | 2 | 1969.0 | same-strand | Ras family |
| 7 | PF08541.12 | 1.0 | 2 | 879.0 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal |
| 8 | PF08545.12 | 1.0 | 2 | 879.0 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III |
| 9 | PF01783.25 | 1.0 | 2 | 592.0 | same-strand | Ribosomal L32p protein family |
| 10 | PF02620.19 | 1.0 | 2 | 42.5 | same-strand | Large ribosomal RNA subunit accumulation protein YceD |
++ More..