Result : EXP03630
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03630 |
| NCBI Accession ID | |
| Organism | Eubacterium,Clostridium,Faecalibacterium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGCTTACAACAGAACTGTTTATAGCCATTATCAGCTTATGTATTACCTGCTTTGCTCTTGGTTATGCCATCGGTTCTAAGAGTGAAAAATAA |
| Sequence | MLTTELFIAIISLCITCFALGYAIGSKSEK |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 160258 | 160350 | + | NC_012780.1 | [Eubacterium] eligens ATCC 27750 |
| 2 | 3032778 | 3032882 | + | NZ_LR027880.1 | Roseburia intestinalis L1-82 |
| 3 | 2189018 | 2189119 | - | NZ_CP070062.1 | Coprococcus comes |
| 4 | 1532492 | 1532581 | + | NZ_CP070062.1 | Coprococcus comes |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR027880.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01554.20 | 0.67 | 2 | 477 | opposite-strand | MatE |
| 2 | PF14667.8 | 0.67 | 2 | 2296.5 | opposite-strand | Polysaccharide biosynthesis C-terminal domain |
| 3 | PF01381.24 | 0.67 | 2 | 618 | opposite-strand | Helix-turn-helix |
| 4 | PF12844.9 | 0.67 | 2 | 618 | opposite-strand | Helix-turn-helix domain |
| 5 | PF14198.8 | 0.67 | 2 | 1145.5 | both-strands | Transposon-encoded protein TnpV |
++ More..