Result : B9MKZ9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S20 |
| NCBI Accession ID | CP001393.1 |
| Organism | Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / Z-1320) (Anaerocellum thermophilum) |
| Left | 2024859 |
| Right | 2025158 |
| Strand | + |
| Nucleotide Sequence | TTGGCAAACACAAAGTCTGCTAAAAAGAAGATAAAGGTTATAAGACGTAGAACTATTGAAAATAAGATTCAAAAATTTAAAATGAAAAAGGCTATAAAAGAGGTCAAAAAAGCACTGCTTAGCGGTGACATCGAAAAGGCAAAAGAACTTTACTCAAAAGCTGCAAAGCTCATTGACCAAACAGCTGCAAAAGGCGTAATTCATAAGAACAATGCTTCAAGAAAGAAATCAAGACTTATGAAACTAATCAACAAGTACGCTGCTCTGTCTTCACCACAGCCAGAATCAAAAGCTCAATAA |
| Sequence | MANTKSAKKKIKVIRRRTIENKIQKFKMKKAIKEVKKALLSGDIEKAKELYSKAAKLIDQTAAKGVIHKNNASRKKSRLMKLINKYAALSSPQPESKAQ |
| Source of smORF | Swiss-Prot |
| Function | Binds directly to 16S ribosomal RNA. {ECO:0000255|HAMAP-Rule:MF_00500}. |
| Pubmed ID | |
| Domain | CDD:412349 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B9MKZ9 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1705207 | 1705506 | + | NC_014657.1 | Caldicellulosiruptor owensensis OL |
| 2 | 1859134 | 1859433 | + | NC_014392.1 | Caldicellulosiruptor obsidiansis OB47 |
| 3 | 1625871 | 1626170 | + | NC_015949.1 | Caldicellulosiruptor lactoaceticus 6A |
| 4 | 905647 | 905946 | - | NC_014652.1 | Caldicellulosiruptor hydrothermalis 108 |
| 5 | 849347 | 849646 | - | NC_014721.1 | Caldicellulosiruptor kristjanssonii I77R1B |
| 6 | 945263 | 945562 | - | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 7 | 2024859 | 2025158 | + | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
| 8 | 1981956 | 1982255 | + | NZ_CP034791.1 | Caldicellulosiruptor changbaiensis |
| 9 | 1156739 | 1157038 | - | NC_009437.1 | Caldicellulosiruptor saccharolyticus DSM 8903 |
| 10 | 895200 | 895466 | - | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 11 | 2335015 | 2335281 | + | NZ_CP032416.1 | Clostridium fermenticellae |
| 12 | 348241 | 348513 | - | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 13 | 2036282 | 2036545 | + | NZ_CP048649.1 | Aminipila butyrica |
| 14 | 888472 | 888744 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_014657.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 0.64 | 9 | 1577 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF00056.25 | 0.64 | 9 | 123 | same-strand | lactate/malate dehydrogenase, NAD binding domain |
| 3 | PF02866.20 | 0.64 | 9 | 123 | same-strand | lactate/malate dehydrogenase, alpha/beta C-terminal domain |
| 4 | PF06144.15 | 0.93 | 13 | 49 | opposite-strand | DNA polymerase III, delta subunit |
| 5 | PF03772.18 | 0.93 | 13 | 1067 | opposite-strand | Competence protein |
| 6 | PF13567.8 | 0.79 | 11 | 1067 | opposite-strand | Domain of unknown function (DUF4131) |
| 7 | PF00753.29 | 0.71 | 10 | 1067.0 | opposite-strand | Metallo-beta-lactamase superfamily |
++ More..