Result : EXP03369
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03369 |
| NCBI Accession ID | |
| Organism | Bacteroides |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGTTGTTCACGCTCGGTGGATTGGGCATTTGGACCTTCATCGACTGGATTATGATCCTGGCCGGTAAGTTCACCGACAAAGAGGGCCGTACCTTGCTGAATTGGTAA |
| Sequence | MLFTLGGLGIWTFIDWIMILAGKFTDKEGRTLLNW |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 35 |
++ More..
| Conservation Analysis |
No. of Species: 63
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3284510 | 3284620 | - | NC_015514.1 | Cellulomonas fimi ATCC 484 |
| 2 | 4102097 | 4102213 | - | NZ_CP072827.1 | Streptomyces mobaraensis NBRC 13819 = DSM 40847 |
| 3 | 735419 | 735538 | + | NC_015671.1 | Cellulomonas gilvus ATCC 13127 |
| 4 | 124406 | 124513 | + | NZ_CP019980.1 | Lysinibacillus sphaericus |
| 5 | 4618755 | 4618862 | - | NZ_CP006837.1 | Lysinibacillus varians |
| 6 | 3007952 | 3008062 | - | NZ_LR134501.1 | Nocardiopsis dassonvillei |
| 7 | 593085 | 593192 | + | NZ_CP046932.1 | Brachyspira hyodysenteriae |
| 8 | 589941 | 590042 | - | NZ_CP034248.1 | Paenibacillus lentus |
| 9 | 1220268 | 1220396 | + | NZ_CP007128.1 | Gemmatirosa kalamazoonesis |
| 10 | 9126965 | 9127078 | + | NZ_CP012333.1 | Labilithrix luteola |
| 11 | 4896398 | 4896505 | + | NZ_CP046378.1 | Shewanella algae |
| 12 | 3849083 | 3849202 | - | NZ_CP045643.1 | Streptomyces fagopyri |
| 13 | 704369 | 704473 | + | NZ_CP024199.1 | Thalassospira marina |
| 14 | 1201650 | 1201757 | - | NC_017243.1 | Brachyspira intermedia PWS/A |
| 15 | 4287013 | 4287120 | - | NZ_CP041783.1 | Shewanella donghaensis |
| 16 | 1540840 | 1540932 | + | NZ_CP058235.1 | Bartonella alsatica |
| 17 | 4415423 | 4415533 | + | NZ_CP037952.1 | Parashewanella spongiae |
| 18 | 750808 | 750903 | - | NZ_CP011112.1 | Luteipulveratus mongoliensis |
| 19 | 1614193 | 1614291 | - | NZ_CP033433.1 | Cohnella candidum |
| 20 | 3743673 | 3743792 | - | NZ_CP032427.1 | Streptomyces griseorubiginosus |
| 21 | 3477775 | 3477900 | - | NZ_CP034687.1 | Streptomyces griseoviridis |
| 22 | 4288612 | 4288707 | - | NC_016609.1 | Niastella koreensis GR20-10 |
| 23 | 2139228 | 2139338 | - | NC_013720.1 | Pirellula staleyi DSM 6068 |
| 24 | 1560371 | 1560472 | + | NC_014666.1 | Frankia inefficax |
| 25 | 3294054 | 3294173 | + | NZ_CP023202.1 | Streptomyces xinghaiensis S187 |
| 26 | 4220893 | 4221012 | - | NC_003155.5 | Streptomyces avermitilis MA-4680 = NBRC 14893 |
| 27 | 4204998 | 4205102 | + | NZ_CP019791.1 | Anaerohalosphaera lusitana |
| 28 | 2899530 | 2899640 | + | NZ_AP017900.1 | Nocardia seriolae |
| 29 | 128588 | 128713 | + | NZ_CP030074.1 | Streptomyces cadmiisoli |
| 30 | 127682 | 127801 | + | NZ_CP030074.1 | Streptomyces cadmiisoli |
| 31 | 3981855 | 3981974 | - | NC_013929.1 | Streptomyces scabiei 87.22 |
| 32 | 3221115 | 3221213 | - | NZ_CP048788.1 | Roseobacter ponti |
| 33 | 10586709 | 10586813 | + | NC_010162.1 | Sorangium cellulosum So ce56 |
| 34 | 574961 | 575065 | + | NZ_CP036274.1 | Anatilimnocola aggregata |
| 35 | 4554 | 4661 | - | NZ_CP009896.1 | Pimelobacter simplex |
| 36 | 4946810 | 4946923 | + | NZ_CP012382.1 | Streptomyces ambofaciens ATCC 23877 |
| 37 | 1451253 | 1451360 | + | NZ_CP020414.2 | Leptospira interrogans serovar Copenhageni |
| 38 | 1472852 | 1472941 | - | NZ_CP019607.1 | Tessaracoccus flavescens |
| 39 | 1963426 | 1963548 | - | NZ_CP026948.1 | Corynebacterium liangguodongii |
| 40 | 4663368 | 4663487 | - | NZ_CP042266.1 | Streptomyces qinzhouensis |
| 41 | 4784344 | 4784463 | - | NZ_CP020700.1 | Streptomyces tsukubensis |
| 42 | 4494229 | 4494342 | + | NZ_CP015866.1 | Streptomyces parvulus |
| 43 | 4493349 | 4493462 | + | NZ_CP015866.1 | Streptomyces parvulus |
| 44 | 6782070 | 6782189 | + | NZ_CP045096.1 | Streptomyces phaeolivaceus |
| 45 | 2963619 | 2963714 | - | NZ_CP019650.1 | Microbulbifer agarilyticus |
| 46 | 2176963 | 2177073 | + | NZ_AP018164.1 | Mycobacterium shigaense |
| 47 | 4282665 | 4282775 | + | NZ_AP018920.1 | Pseudonocardia autotrophica |
| 48 | 3019439 | 3019528 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 49 | 4288497 | 4288595 | - | NC_016940.1 | Saprospira grandis str. Lewin |
| 50 | 288823 | 288924 | - | NZ_CP009498.1 | Endomicrobium proavitum |
| 51 | 4936839 | 4936958 | + | NZ_CP023703.1 | Streptomyces galilaeus |
| 52 | 1565280 | 1565387 | + | NC_016906.1 | Gordonia polyisoprenivorans VH2 |
| 53 | 1062464 | 1062565 | + | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 54 | 4473137 | 4473259 | + | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 55 | 2833748 | 2833834 | + | NZ_CP054938.1 | Streptomyces harbinensis |
| 56 | 2834547 | 2834666 | + | NZ_CP054938.1 | Streptomyces harbinensis |
| 57 | 3116442 | 3116549 | + | NZ_LR134352.1 | Nocardia asteroides |
| 58 | 922084 | 922188 | - | NC_017025.1 | Flavobacterium indicum GPTSA100-9 = DSM 17447 |
| 59 | 2626148 | 2626234 | + | NZ_CP009922.3 | Streptomyces xiamenensis |
| 60 | 2626950 | 2627063 | + | NZ_CP009922.3 | Streptomyces xiamenensis |
| 61 | 1260508 | 1260630 | - | NZ_CP045309.1 | Micromonospora terminaliae |
| 62 | 3198344 | 3198463 | - | NC_016109.1 | Kitasatospora setae KM-6054 |
| 63 | 6516335 | 6516433 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 64 | 3712415 | 3712510 | - | NZ_CP032157.1 | Paraflavitalea soli |
| 65 | 347646 | 347741 | + | NZ_CP018258.1 | Dehalogenimonas formicexedens |
| 66 | 2722103 | 2722201 | - | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 67 | 2988968 | 2989090 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
++ More..