Protein Information |
Information Type | Description |
---|---|
Protein name | EXP03353 |
NCBI Accession ID | |
Organism | Faecalibacterium,Flavonifractor,Alistipes |
Left | |
Right | |
Strand | |
Nucleotide Sequence | ATGACTACCACTACCTTAGTTGAGAGCCTGTCTCGCCTTTACGAACACGGTCGCCTGACCAAGGCTGGCATCGCAGCCCGCGTCAAAAAGGGTACCATCACCGAGGACGACTACAAAACCATCACTGGCGAGGAATACAAGGATGCCTAA |
Sequence | MTTTTLVESLSRLYEHGRLTKAGIAARVKKGTITEDDYKTITGEEYKDA |
Source of smORF | Metagenomic Ribo-seq |
Function | The ORF matches to the profile of cl23995. Profile Description: Phage uncharacterized protein (Phage_XkdX). This model represents a family of small (about 50 amino acid) phage proteins, found in at least 12 different phage and prophage regions of Gram-positive bacteria. In a number of these phage, the gene for this protein is found near the holin and endolysin genes. [Mobile and extrachromosomal element functions, Prophage functions] |
Pubmed ID | 32601270 |
Domain | CDD:420140 |
Functional Category | Conserved domain based functional assignment |
Uniprot ID | |
ORF Length (Amino Acid) | 49 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2058676 | 2058798 | + | NZ_CP036170.1 | [Clostridium] scindens ATCC 35704 |
2 | 2038123 | 2038254 | + | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF18454.3 | 1.0 | 2 | 3024.0 | same-strand | Major tropism determinant N-terminal domain |