Result : EXP03353

Protein Information

• Protein name: EXP03353
• Organism: Faecalibacterium,Flavonifractor,Alistipes
• Nucleotide Sequence: ATGACTACCACTACCTTAGTTGAGAGCCTGTCTCGCCTTTACGAACACGGTCGCCTGACCAAGGCTGGCATCGCAGCCCGCGTCAAAAAGGGTACCATCACCGAGGACGACTACAAAACCATCACTGGCGAGGAATACAAGGATGCCTAA
• Sequence: MTTTTLVESLSRLYEHGRLTKAGIAARVKKGTITEDDYKTITGEEYKDA
• Source of smORF: Metagenomic Ribo-seq
• Function: The ORF matches to the profile of cl23995. Profile Description: Phage uncharacterized protein (Phage_XkdX). This model represents a family of small (about 50 amino acid) phage proteins, found in at least 12 different phage and prophage regions of Gram-positive bacteria. In a number of these phage, the gene for this protein is found near the holin and endolysin genes. [Mobile and extrachromosomal element functions, Prophage functions]
• Pubmed ID: 32601270
• Domain: CDD:420140
• Functional Category: Conserved domain based functional assignment
• ORF Length (Amino Acid): 49

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2058676	2058798	+	NZ_CP036170.1	[Clostridium] scindens ATCC 35704
2	2038123	2038254	+	NZ_CP022413.2	Blautia hansenii DSM 20583

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP036170.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF18454.3	1.0	2	3024.0	same-strand	Major tropism determinant N-terminal domain