Result : EXP03352
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03352 |
| NCBI Accession ID | |
| Organism | Monoglobus |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGATTTCAACAATAATAGTTTCAATTATTCTTTTGGCCATTGTGTCTGCAATAGTAATACACTTGGTCAGGAAGAAAAAACGCGGCAAAGGTTCTTGCGGATGTGGATGCGACAGCTGCGGAATGTCAAAATATTGTCATAAGGATTGA |
| Sequence | MISTIIVSIILLAIVSAIVIHLVRKKKRGKGSCGCGCDSCGMSKYCHKD |
| Source of smORF | Metagenomic Ribo-seq |
| Function | The ORF matches to the profile of pfam12669. Profile Description: Virus attachment protein p12 family. This family of proteins are related to Virus attachment protein p12 from the African swine fever virus. The family appears to contain an N-terminal signal peptide followed by a short cysteine rich region. The cysteine rich region is extremely variable and it is possible that only the N-terminal region is homologous. |
| Pubmed ID | 32601270 |
| Domain | CDD:403765 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 49 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1901725 | 1901859 | + | NC_020134.1 | Thermoclostridium stercorarium subsp. stercorarium DSM 8532 |
| 2 | 1068301 | 1068423 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_020134.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04023.16 | 1.0 | 2 | 2549.0 | same-strand | FeoA domain |
| 2 | PF02421.20 | 1.0 | 2 | 61.5 | same-strand | Ferrous iron transport protein B |
| 3 | PF07670.16 | 1.0 | 2 | 61.5 | same-strand | Nucleoside recognition |
| 4 | PF07664.14 | 1.0 | 2 | 61.5 | same-strand | Ferrous iron transport protein B C terminus |
| 5 | PF01926.25 | 1.0 | 2 | 61.5 | same-strand | 50S ribosome-binding GTPase |
| 6 | PF17910.3 | 1.0 | 2 | 61.5 | same-strand | FeoB cytosolic helical domain |
++ More..