Result : B9KXC8
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S16 |
| NCBI Accession ID | CP001275.1 |
| Organism | Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2) |
| Left | 120041 |
| Right | 120340 |
| Strand | - |
| Nucleotide Sequence | ATGATCAAGCTGCGCCTACGCCGCATGGGGAAGAAGAGGCAGCCGCACTACCGGATCGTCGCGGCCGAGGCACGTTGGCCCCGCGATGGCCGGTTCATCGAGGTTATCGGGTATTACAACCCCCGCACCGATCCGTATACGCTCGAAGTGAATGTCGAGCGAGCGCGGTGGTGGCTCGAGCATGGGGCACAGCCGACTGATACGGTCCGTGCTCTCTTGGTTCGTGCCGGCGTCCTTCCACCGCGTCAGCAGAACGAGGCCAAGCGCGAAACTGCCGAAACCGCGCAGCCCGAGGCATGA |
| Sequence | MIKLRLRRMGKKRQPHYRIVAAEARWPRDGRFIEVIGYYNPRTDPYTLEVNVERARWWLEHGAQPTDTVRALLVRAGVLPPRQQNEAKRETAETAQPEA |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00368. Profile Description: Ribosomal protein S16. This model describes ribosomal S16 of bacteria and organelles. [Protein synthesis, Ribosomal proteins: synthesis and modification] |
| Pubmed ID | 19148287 |
| Domain | CDD:412339 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B9KXC8 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 75
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 120041 | 120340 | - | NC_011959.1 | Thermomicrobium roseum DSM 5159 |
| 2 | 1770172 | 1770462 | - | NC_013525.1 | Thermobaculum terrenum ATCC BAA-798 |
| 3 | 1451801 | 1452061 | - | NZ_CP014164.1 | Aerococcus viridans |
| 4 | 4430649 | 4430969 | - | NZ_CP007128.1 | Gemmatirosa kalamazoonesis |
| 5 | 724650 | 724910 | + | NZ_CP013988.1 | Aerococcus urinaeequi |
| 6 | 1169491 | 1169736 | + | NC_014831.1 | Thermaerobacter marianensis DSM 12885 |
| 7 | 985556 | 985828 | + | NZ_CP013213.1 | Erysipelothrix larvae |
| 8 | 1467320 | 1467598 | + | NC_014098.1 | Kyrpidia tusciae DSM 2912 |
| 9 | 114192 | 114446 | - | NZ_CP018888.1 | Amylolactobacillus amylophilus DSM 20533 = JCM 1125 |
| 10 | 2184487 | 2184759 | + | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 11 | 1005058 | 1005324 | + | NZ_CP014141.1 | Thermus parvatiensis |
| 12 | 1790523 | 1790801 | - | NZ_CP024955.1 | Kyrpidia spormannii |
| 13 | 1040598 | 1040843 | + | NZ_CP014159.1 | Aerococcus christensenii |
| 14 | 2793215 | 2793469 | - | NZ_CP011454.1 | Gemmatimonas phototrophica |
| 15 | 1708251 | 1708496 | + | NZ_AP017312.1 | Aneurinibacillus soli |
| 16 | 1251201 | 1251467 | + | NC_015519.1 | Tepidanaerobacter acetatoxydans Re1 |
| 17 | 302035 | 302277 | - | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 18 | 2250791 | 2251033 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 19 | 869434 | 869703 | + | NZ_CP011391.1 | Faecalibaculum rodentium |
| 20 | 2300888 | 2301142 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 21 | 508985 | 509230 | + | NZ_CP014161.1 | Aerococcus urinae |
| 22 | 2922376 | 2922624 | - | NZ_CP012033.1 | Levilactobacillus koreensis |
| 23 | 63365 | 63649 | - | NC_011653.1 | Thermosipho africanus TCF52B |
| 24 | 2104733 | 2104981 | - | NZ_CP059603.1 | Levilactobacillus suantsaii |
| 25 | 1539628 | 1539900 | - | NC_015387.1 | Marinithermus hydrothermalis DSM 14884 |
| 26 | 2931751 | 2931996 | - | NZ_CP022657.1 | Tumebacillus algifaecis |
| 27 | 3434205 | 3434450 | + | NZ_CP021434.1 | Tumebacillus avium |
| 28 | 1954699 | 1954965 | - | NZ_CP048104.1 | Kroppenstedtia pulmonis |
| 29 | 9948472 | 9948735 | + | NZ_CP035758.1 | Ktedonosporobacter rubrisoli |
| 30 | 1090720 | 1090965 | + | NC_015520.1 | Mahella australiensis 50-1 BON |
| 31 | 1102829 | 1103077 | + | NZ_LS483405.1 | Levilactobacillus brevis |
| 32 | 667863 | 668111 | + | NZ_CP011403.1 | Ligilactobacillus salivarius str. Ren |
| 33 | 1607907 | 1608173 | + | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 34 | 948642 | 948887 | - | NZ_CP031092.1 | Salicibibacter kimchii |
| 35 | 4652719 | 4652964 | + | NZ_CP041217.1 | Saccharibacillus brassicae |
| 36 | 747055 | 747300 | + | NZ_CP027563.1 | Weissella confusa |
| 37 | 1000618 | 1000881 | - | NZ_CP010822.1 | Thermus aquaticus Y51MC23 |
| 38 | 2793123 | 2793371 | - | NZ_CP049887.1 | Vagococcus hydrophili |
| 39 | 736361 | 736609 | + | NZ_CP032626.1 | Apilactobacillus bombintestini |
| 40 | 1078815 | 1079060 | + | NZ_AP019309.1 | Intestinibaculum porci |
| 41 | 839275 | 839523 | + | NZ_CP017267.1 | Vagococcus teuberi |
| 42 | 1951194 | 1951439 | + | NZ_CP045875.1 | Heliorestis convoluta |
| 43 | 1445569 | 1445817 | + | NZ_CP060720.1 | Vagococcus carniphilus |
| 44 | 854699 | 854947 | + | NZ_CP047141.1 | Ligilactobacillus animalis |
| 45 | 621237 | 621488 | + | NZ_CP045562.1 | Fructilactobacillus fructivorans |
| 46 | 1576588 | 1576836 | + | NZ_CP023011.2 | Enterococcus hirae |
| 47 | 1052095 | 1052343 | + | NZ_CP049886.1 | Vagococcus coleopterorum |
| 48 | 1088665 | 1088913 | + | NZ_CP039712.1 | Vagococcus zengguangii |
| 49 | 942398 | 942643 | + | NZ_CP039712.1 | Vagococcus zengguangii |
| 50 | 1965693 | 1965941 | - | NZ_CP042371.1 | Secundilactobacillus malefermentans |
| 51 | 1020204 | 1020452 | - | NZ_CP044534.1 | Limosilactobacillus frumenti |
| 52 | 938183 | 938428 | - | NZ_CP035485.1 | Salicibibacter halophilus |
| 53 | 2369952 | 2370200 | + | NZ_CP018796.1 | Lentilactobacillus parabuchneri |
| 54 | 1068508 | 1068759 | - | NZ_CP045530.1 | Limosilactobacillus pontis |
| 55 | 1788806 | 1789093 | - | NZ_CP007389.1 | Thermosipho melanesiensis |
| 56 | 2826218 | 2826475 | - | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 57 | 1280297 | 1280539 | - | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 58 | 2728467 | 2728733 | - | NC_012489.1 | Gemmatimonas aurantiaca T-27 |
| 59 | 1243999 | 1244247 | - | NZ_CP045605.1 | Limosilactobacillus reuteri |
| 60 | 1794948 | 1795193 | - | NZ_AP022822.1 | Enterococcus saigonensis |
| 61 | 708470 | 708733 | + | NZ_CP014324.1 | Oenococcus oeni |
| 62 | 2476360 | 2476608 | - | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 63 | 1928728 | 1928979 | + | NZ_CP023392.1 | Lactococcus raffinolactis |
| 64 | 552855 | 553103 | + | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 65 | 679720 | 679965 | + | NZ_CP044496.1 | Lactobacillus acetotolerans |
| 66 | 1597923 | 1598171 | - | NZ_LS483306.1 | Enterococcus cecorum |
| 67 | 1954439 | 1954687 | - | NZ_CP018061.1 | Enterococcus mundtii |
| 68 | 918089 | 918337 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 69 | 994375 | 994623 | + | NZ_CP065211.1 | Enterococcus lactis |
| 70 | 751547 | 751795 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 71 | 857619 | 857894 | + | NZ_LT906464.1 | Staphylococcus muscae |
| 72 | 4139676 | 4139930 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 73 | 1197305 | 1197556 | - | NZ_CP017194.1 | Lactococcus carnosus |
| 74 | 1239128 | 1239379 | - | NZ_CP017195.1 | Lactococcus paracarnosus |
| 75 | 6538059 | 6538319 | + | NC_019751.1 | Calothrix sp. PCC 6303 |
| 76 | 1025450 | 1025698 | + | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_014831.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01782.20 | 0.88 | 66 | 360.5 | same-strand | RimM N-terminal domain |
| 2 | PF05239.18 | 0.85 | 64 | 361.5 | same-strand | PRC-barrel domain |
| 3 | PF13083.8 | 0.85 | 64 | 14.0 | same-strand | KH domain |
| 4 | PF01746.23 | 0.83 | 62 | 880.5 | same-strand | tRNA (Guanine-1)-methyltransferase |
| 5 | PF00448.24 | 0.68 | 51 | 184.0 | same-strand | SRP54-type protein, GTPase domain |
| 6 | PF02978.21 | 0.68 | 51 | 120 | same-strand | Signal peptide binding domain |
| 7 | PF02881.21 | 0.68 | 51 | 184.0 | same-strand | SRP54-type protein, helical bundle domain |
| 8 | PF01245.22 | 0.64 | 48 | 2064.5 | same-strand | Ribosomal protein L19 |
++ More..