Result : EXP03282
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP03282 |
| NCBI Accession ID | |
| Organism | Butyrivibrio,Clostridium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGATGAAAATAATAAGCTCAGTTATAGTAGGTATTATTCTTTTAGCATTAGTTTTTCTTGTAATCAGGAGTATGGTCAGGGATAAGAAGGCCGGTAAGGGTATCTGCGGCGGTGATTGCAGTGCATGTAAGGGCTGCCATTGTAAATAA |
| Sequence | MMKIISSVIVGIILLALVFLVIRSMVRDKKAGKGICGGDCSACKGCHCK |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 49 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 753568 | 753705 | + | NZ_LR699011.1 | Roseburia hominis |
| 2 | 551766 | 551903 | + | NZ_CP014223.1 | Anaerotignum propionicum DSM 1682 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR699011.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04023.16 | 1.0 | 2 | 2409.5 | same-strand | FeoA domain |
| 2 | PF02421.20 | 1.0 | 2 | 21.5 | same-strand | Ferrous iron transport protein B |
| 3 | PF07670.16 | 1.0 | 2 | 21.5 | same-strand | Nucleoside recognition |
| 4 | PF07664.14 | 1.0 | 2 | 21.5 | same-strand | Ferrous iron transport protein B C terminus |
| 5 | PF01926.25 | 1.0 | 2 | 21.5 | same-strand | 50S ribosome-binding GTPase |
| 6 | PF17910.3 | 1.0 | 2 | 21.5 | same-strand | FeoB cytosolic helical domain |
++ More..