Result : B8GWS7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division inhibitor SidA (SOS-induced inhibitor of cell division A) |
| NCBI Accession ID | CP001340.1 |
| Organism | Caulobacter vibrioides (strain NA1000 / CB15N) (Caulobacter crescentus) |
| Left | 2152374 |
| Right | 2152463 |
| Strand | - |
| Nucleotide Sequence | ATGATCCGTGTCGCGCGTGAGTCTTTCGCCCTTGTTTCTGTGATCGGCTTCGTCTGGATGATGTGCACGGTGGCCAATCTCGTGGCCTGA |
| Sequence | MIRVARESFALVSVIGFVWMMCTVANLVA |
| Source of smORF | Swiss-Prot |
| Function | Inhibits cell division by binding directly to FtsW to prevent the final constriction of the FtsZ ring. {ECO:0000269|Pubmed:21685367}. |
| Pubmed ID | 20472802 21685367 |
| Domain | CDD:380224 |
| Functional Category | Others |
| Uniprot ID | B8GWS7 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2152374 | 2152463 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 1852666 | 1852755 | + | NZ_CP013002.1 | Caulobacter henricii |
| 3 | 3739874 | 3739963 | + | NZ_CP026100.1 | Caulobacter flavus |
| 4 | 2440863 | 2440952 | - | NZ_CP024201.1 | Caulobacter mirabilis |
| 5 | 1461898 | 1461987 | - | NZ_CP029479.1 | Phenylobacterium parvum |
| 6 | 1995850 | 1995939 | - | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 7 | 64631 | 64723 | - | NZ_CP022048.2 | Brevundimonas vesicularis |
| 8 | 2521343 | 2521432 | - | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00889.21 | 0.62 | 5 | 5515 | same-strand | Elongation factor TS |
| 2 | PF00318.22 | 0.75 | 6 | 4491.0 | same-strand | Ribosomal protein S2 |
| 3 | PF07733.14 | 1.0 | 8 | 32.5 | same-strand | Bacterial DNA polymerase III alpha NTPase domain |
| 4 | PF17657.3 | 1.0 | 8 | 32.5 | same-strand | Bacterial DNA polymerase III alpha subunit finger domain |
| 5 | PF02811.21 | 1.0 | 8 | 32.5 | same-strand | PHP domain |
| 6 | PF14579.8 | 1.0 | 8 | 32.5 | same-strand | Helix-hairpin-helix motif |
| 7 | PF01336.27 | 1.0 | 8 | 32.5 | same-strand | OB-fold nucleic acid binding domain |
| 8 | PF00005.29 | 0.88 | 7 | 1125 | same-strand | ABC transporter |
| 9 | PF12704.9 | 0.88 | 7 | 1804 | same-strand | MacB-like periplasmic core domain |
| 10 | PF02687.23 | 0.88 | 7 | 1804 | same-strand | FtsX-like permease family |
| 11 | PF00587.27 | 0.62 | 5 | 3084 | same-strand | tRNA synthetase class II core domain (G, H, P, S and T) |
| 12 | PF03129.22 | 0.62 | 5 | 3084 | same-strand | Anticodon binding domain |
| 13 | PF07330.14 | 0.62 | 5 | 4717 | same-strand | Protein of unknown function (DUF1467) |
++ More..