Result : B8F4W0
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Cell division protein FtsB |
| NCBI Accession ID | CP001321.1 |
| Organism | Haemophilus parasuis serovar 5 (strain SH0165) (Glaesserella parasuis) |
| Left | 725472 |
| Right | 725753 |
| Strand | - |
| Nucleotide Sequence | ATGCGAGTTTTAGTTGTCGTTTTAGCACTTTTATTAGGTGGTTTCCAGTATGCGTTTTGGTTTGGGCAAAACGGTTGGAATGAATACCAACAAGCTAAACAAGAAGTCTCTCAACTGAAAGAAACTAATCAGAAACTGACCGCTCGTAATCAACTTATTCAAGCCGAAATCGAAGATTTAAAAACGGGTATCAATGCCCTTGAAGAACGAGCAAGGCTTGATCGTGAAATGGTTAAACCAGATGAAACGTTTTATCGCATCGTCCCAAGAGAGCAACGTTAA |
| Sequence | MRVLVVVLALLLGGFQYAFWFGQNGWNEYQQAKQEVSQLKETNQKLTARNQLIQAEIEDLKTGINALEERARLDREMVKPDETFYRIVPREQR |
| Source of smORF | Swiss-Prot |
| Function | Essential cell division protein. May link together the upstream cell division proteins, which are predominantly cytoplasmic, with the downstream cell division proteins, which are predominantly periplasmic. {ECO:0000255|HAMAP-Rule:MF_00599}. |
| Pubmed ID | 19074396 |
| Domain | CDD:416267 |
| Functional Category | Others |
| Uniprot ID | B8F4W0 |
| ORF Length (Amino Acid) | 93 |
++ More..
| Conservation Analysis |
No. of Species: 29
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 725472 | 725753 | - | NC_011852.1 | Glaesserella parasuis SH0165 |
| 2 | 1858998 | 1859279 | + | NZ_CP029206.1 | Actinobacillus porcitonsillarum |
| 3 | 580369 | 580647 | - | NZ_CP007715.1 | Actinobacillus equuli subsp. equuli |
| 4 | 1761176 | 1761454 | + | NZ_CP061280.1 | Mannheimia bovis |
| 5 | 587635 | 587913 | - | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
| 6 | 893042 | 893320 | - | NZ_CP006944.1 | Mannheimia varigena USDA-ARS-USMARC-1312 |
| 7 | 767236 | 767511 | + | NZ_CP016604.1 | Otariodibacter oris |
| 8 | 1030711 | 1030989 | + | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |
| 9 | 930926 | 931204 | + | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
| 10 | 1802544 | 1802819 | + | NZ_CP015029.1 | Frederiksenia canicola |
| 11 | 1255666 | 1255935 | - | NZ_CP046531.1 | Mannheimia ovis |
| 12 | 1407875 | 1408144 | - | NZ_CP055305.1 | Mannheimia pernigra |
| 13 | 11635 | 11910 | - | NZ_CP015425.1 | [Haemophilus] ducreyi |
| 14 | 1131393 | 1131668 | - | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
| 15 | 1928758 | 1929039 | + | NZ_CP018804.1 | Histophilus somni |
| 16 | 1806993 | 1807271 | - | NZ_LT906448.1 | Pasteurella dagmatis |
| 17 | 936750 | 937028 | - | NZ_LR134167.1 | Avibacterium volantium |
| 18 | 418105 | 418383 | + | NZ_LS483443.1 | Aggregatibacter segnis ATCC 33393 |
| 19 | 1393938 | 1394216 | - | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
| 20 | 861805 | 862083 | - | NZ_CP028926.1 | Pasteurella multocida |
| 21 | 401652 | 401930 | - | NZ_LR134510.1 | Actinobacillus delphinicola |
| 22 | 567830 | 568111 | + | NZ_CP031781.1 | Vibrio parahaemolyticus |
| 23 | 576350 | 576628 | + | NZ_CP040021.1 | Salinivibrio kushneri |
| 24 | 679970 | 680209 | - | NZ_CP016180.1 | Pasteurella skyensis |
| 25 | 884295 | 884579 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 26 | 812041 | 812322 | - | NC_006512.1 | Idiomarina loihiensis L2TR |
| 27 | 3818614 | 3818883 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 28 | 886990 | 887280 | - | NZ_CP053416.1 | Salmonella bongori |
| 29 | 526122 | 526370 | - | NZ_CP029347.1 | Saliniradius amylolyticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011852.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02542.18 | 0.97 | 28 | 709.0 | same-strand | YgbB family |
| 2 | PF01128.21 | 1.0 | 29 | 13 | same-strand | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
++ More..