ProsmORF-pred
Result : A1JT31
Protein Information
Information Type Description
Protein name Negative regulator of flagellin synthesis (Anti-sigma-28 factor)
NCBI Accession ID U16136.1
Organism Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Left 90
Right 389
Strand +
Nucleotide Sequence ATGAGTATTGATCGCACTCAGCCGCTATTACCGGTAACACCAGTGCAGCCACGGGAAACCAGTGATATTGCGCAACAAACGCGTAAACCTTCTGCTCAATCAAAAACACCGGTAAGTGGTACTGAGGTTAAATTGAGCGACGCGCAGGCAAAATTGATGCAACCGGGCAGCCAGGACATCAATGTAGAACGTGTCGAAACCTTAAAACAGGCGATCCGTTCAGGCCAACTGACCATGGACACCGGTAAAATTGCCGATGCCTTGCTCAAAAATGTTGCCGATGACCTGAAGAATAGCTAA
Sequence MSIDRTQPLLPVTPVQPRETSDIAQQTRKPSAQSKTPVSGTEVKLSDAQAKLMQPGSQDINVERVETLKQAIRSGQLTMDTGKIADALLKNVADDLKNS
Source of smORF Swiss-Prot
Function Responsible for the coupling of flagellin expression to flagellar assembly by preventing expression of the flagellin genes when a component of the middle class of proteins is defective. It negatively regulates flagellar genes by inhibiting the activity of FliA by directly binding to FliA (By similarity). {ECO:0000250}.
Pubmed ID 8830263 17173484
Domain CDD:412716
Functional Category Others
Uniprot ID A1JT31
ORF Length (Amino Acid) 99
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 119
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2829937 2830236 + NZ_CP011118.1 Yersinia enterocolitica
2 96204 96503 - NZ_CP009781.1 Yersinia aldovae 670-83
3 2278464 2278763 + NZ_CP032487.1 Yersinia hibernica
4 2797298 2797597 + NZ_CP043727.1 Yersinia canariae
5 1852028 1852327 - NZ_CP046293.1 Yersinia intermedia
6 244064 244363 - NZ_CP009787.1 Yersinia rohdei
7 3091313 3091612 - NZ_CP054043.1 Yersinia mollaretii ATCC 43969
8 3689195 3689497 - NZ_CP007230.1 Yersinia similis
9 2552942 2553244 + NZ_LR134373.1 Yersinia pseudotuberculosis
10 811236 811532 + NZ_CP011078.1 Yersinia ruckeri
11 2889003 2889299 + NZ_CP034036.1 Brenneria nigrifluens DSM 30175 = ATCC 13028
12 2754155 2754454 + NZ_CP050150.1 Hafnia alvei
13 5397662 5397973 + NZ_CP011254.1 Serratia fonticola
14 2981270 2981569 + NZ_CP025799.1 Dickeya zeae
15 1770425 1770724 - NC_012912.1 Dickeya chrysanthemi Ech1591
16 3081739 3082035 + NZ_CP065044.1 Pectobacterium aroidearum
17 3159068 3159364 + NZ_CP009125.1 Pectobacterium atrosepticum
18 1925642 1925938 - NZ_CP034938.1 Pectobacterium odoriferum
19 1905629 1905925 + NZ_CP017482.1 Pectobacterium polaris
20 4878506 4878802 + NZ_CP015750.1 Pectobacterium wasabiae CFBP 3304
21 319136 319435 + NZ_CP015137.1 Dickeya solani IPO 2222
22 2128079 2128375 + NZ_CP015749.1 Pectobacterium parmentieri
23 4575682 4575978 + NZ_CP047495.1 Pectobacterium brasiliense
24 1802883 1803179 - NZ_CP051652.1 Pectobacterium carotovorum
25 2956234 2956530 + NZ_CP038498.1 Pectobacterium punjabense
26 1453183 1453482 - NZ_LT615367.1 Dickeya aquatica
27 3074285 3074584 + NC_014500.1 Dickeya dadantii 3937
28 4643422 4643721 - NZ_CP009460.1 Dickeya fangzhongdai
29 3200434 3200730 - NZ_CP006664.1 Edwardsiella anguillarum ET080813
30 2391852 2392148 + NZ_CP016043.1 Edwardsiella hoshinae
31 447428 447724 + NZ_CP023706.1 Edwardsiella tarda
32 3007731 3008030 + NZ_CP031560.1 Dickeya dianthicola
33 1580294 1580593 - NZ_CP042220.2 Dickeya poaceiphila
34 1331863 1332159 - NC_012779.2 Edwardsiella ictaluri 93-146
35 2875168 2875461 + NZ_LR134201.1 Cedecea lapagei
36 3155053 3155364 + NZ_LT906479.1 Serratia ficaria
37 3252956 3253282 + NC_015567.1 Serratia plymuthica AS9
38 3239587 3239913 + NZ_CP048784.1 Serratia liquefaciens
39 2424383 2424694 + NZ_CP016948.1 Serratia surfactantfaciens
40 1973301 1973612 - NZ_CP071320.1 Serratia ureilytica
41 3125734 3126045 + NZ_CP038662.1 Serratia nematodiphila
42 510136 510429 + NZ_CP044098.1 Citrobacter portucalensis
43 1856141 1856434 + NC_009792.1 Citrobacter koseri ATCC BAA-895
44 2519802 2520092 - NZ_CP051548.1 Phytobacter diazotrophicus
45 3094787 3095080 + NZ_CP023525.1 Cedecea neteri
46 3270532 3270858 + NZ_LR134494.1 Serratia quinivorans
47 4170793 4171098 + NZ_CP007044.2 Chania multitudinisentens RB-25
48 4607693 4607986 - NZ_CP033744.1 Citrobacter freundii
49 2240167 2240463 + NZ_CP014137.1 Brenneria goodwinii
50 1772785 1773078 - NZ_LR134340.1 Escherichia marmotae
51 1723516 1723809 - NZ_CP017184.1 Enterobacter roggenkampii
52 783224 783517 + NZ_CP025034.2 Enterobacter sp. SGAir0187
53 3646277 3646570 - NZ_CP053416.1 Salmonella bongori
54 1568523 1568816 + NZ_CP038469.1 Citrobacter tructae
55 4490045 4490356 + NZ_CP065640.1 Serratia rubidaea
56 1840227 1840526 - NC_014306.1 Erwinia billingiae Eb661
57 3019574 3019861 + NZ_CP013990.1 Leclercia adecarboxylata
58 1993337 1993630 - NZ_CP043318.1 Enterobacter chengduensis
59 1789525 1789818 - NZ_CP027986.1 Enterobacter sichuanensis
60 1257036 1257329 - NC_003197.2 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
61 1230047 1230340 - NC_013716.1 Citrobacter rodentium ICC168
62 1442822 1443118 - NZ_CP034035.1 Brenneria rubrifaciens
63 1757947 1758240 - NZ_AP022508.1 Enterobacter bugandensis
64 2777713 2778006 + NZ_AP023184.1 Buttiauxella agrestis
65 1770310 1770603 - NZ_CP009756.1 Enterobacter cloacae
66 3332936 3333259 + NZ_LR134475.1 Klebsiella aerogenes
67 1253104 1253394 - NZ_CP011602.1 Phytobacter ursingii
68 4248655 4248948 - NZ_AP019007.1 Enterobacter oligotrophicus
69 1742936 1743229 - NC_015968.1 Enterobacter soli
70 1736637 1736930 + NZ_CP045769.1 Enterobacter cancerogenus
71 938927 939220 - NZ_CP017279.1 Enterobacter ludwigii
72 1895574 1895867 - NZ_CP015113.1 Kosakonia radicincitans
73 3902155 3902454 + NZ_CP026364.1 Proteus hauseri
74 897103 897396 + NZ_CP057657.1 Escherichia fergusonii
75 953595 953894 - NZ_CP028271.1 Mixta intestinalis
76 2766822 2767115 + NZ_CP072455.1 Xenorhabdus budapestensis
77 1708603 1708896 - NZ_CP061527.1 Shigella dysenteriae
78 1489120 1489413 - NC_002695.2 Escherichia coli O157:H7 str. Sakai
79 1117596 1117889 - NC_004337.2 Shigella flexneri 2a str. 301
80 1129835 1130128 - NC_000913.3 Escherichia coli str. K-12 substr. MG1655
81 3302075 3302368 + NZ_CP014007.2 Kosakonia oryzae
82 1713598 1713897 - NZ_CP061511.1 Mixta calida
83 2364367 2364660 + NZ_CP012268.1 Cronobacter muytjensii ATCC 51329
84 1717850 1718143 - NZ_CP012266.1 Cronobacter dublinensis subsp. dublinensis LMG 23823
85 1137967 1138260 - NZ_AP014857.1 Escherichia albertii
86 3033277 3033579 + NC_012962.1 Photorhabdus asymbiotica
87 1540839 1541147 - NZ_LN907827.1 Erwinia gerundensis
88 1730048 1730341 + NZ_CP027107.1 Cronobacter sakazakii
89 2475012 2475305 + NZ_CP013940.1 Cronobacter malonaticus LMG 23826
90 470076 470375 - NZ_CP016176.1 Xenorhabdus hominickii
91 1144944 1145237 + NZ_CP045300.1 Kosakonia arachidis
92 1174964 1175257 + NZ_CP016337.1 Kosakonia sacchari
93 1893654 1893947 - NZ_CP063425.1 Kosakonia pseudosacchari
94 2305411 2305710 + NC_010694.1 Erwinia tasmaniensis Et1/99
95 2280636 2280938 - NC_005126.1 Photorhabdus laumondii subsp. laumondii TTO1
96 2904000 2904302 + NC_017554.1 Pantoea ananatis PA13
97 4912882 4913184 + NZ_CP011104.1 Photorhabdus thracensis
98 1505254 1505562 - NZ_CP034148.1 Pantoea agglomerans
99 638568 638867 - NZ_CP023529.1 Lelliottia amnigena
100 2862690 2862983 + NZ_CP035129.1 Kosakonia cowanii
101 1680972 1681265 - NZ_CP012264.1 Cronobacter condimenti 1330
102 1884689 1884988 - NC_013892.1 Xenorhabdus bovienii SS-2004
103 1572200 1572499 - NZ_CP023567.1 Erwinia pyrifoliae
104 1668276 1668569 - NZ_CP012257.1 Cronobacter universalis NCTC 9529
105 2797066 2797362 + NZ_CP054058.1 Scandinavium goeteborgense
106 2615089 2615397 + NZ_CP045720.1 Pantoea eucalypti
107 774203 774505 - NZ_CP067057.1 Rahnella aceris
108 1877030 1877323 - NZ_CP012871.1 [Enterobacter] lignolyticus
109 1766296 1766595 + NC_010554.1 Proteus mirabilis HI4320
110 48132 48428 + NZ_CP042941.1 Atlantibacter hermannii
111 4409401 4409703 - NZ_CP049115.1 Pantoea stewartii
112 1523188 1523487 - NC_013961.1 Erwinia amylovora CFBP1430
113 1770871 1771170 - NZ_CP026377.1 Mixta gaviniae
114 2182840 2183139 + NZ_CP060401.1 Xenorhabdus nematophila
115 3649000 3649293 + NZ_CP045205.1 Citrobacter telavivensis
116 3421411 3421704 - NZ_LT556085.1 Citrobacter amalonaticus
117 3106135 3106428 - NZ_CP020388.1 Pluralibacter gergoviae
118 2788436 2788729 + NZ_CP045845.1 Kluyvera intermedia
119 2528259 2528564 + NZ_CP038853.1 Pantoea vagans
120 1466828 1467124 - NZ_CP065534.1 Lonsdalea populi
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP011118.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF06429.15 0.97 116 2484 opposite-strand Flagellar basal body rod FlgEFG protein C-terminal
2 PF07559.16 0.97 116 2484 opposite-strand Flagellar basal body protein FlaE
3 PF00460.22 1.0 119 1353.5 opposite-strand Flagella basal body rod protein
4 PF03963.16 0.97 116 1764 opposite-strand Flagellar hook capping protein - N-terminal region
5 PF13860.8 0.97 116 1764 opposite-strand FlgD Ig-like domain
6 PF13861.8 0.98 117 1764.0 opposite-strand FlgD Tudor-like domain
7 PF13144.8 1.0 119 105.5 same-strand Chaperone for flagella basal body P-ring formation
8 PF17656.3 0.83 99 123.0 same-strand FlgA N-terminal domain
9 PF08666.14 0.98 117 105.5 same-strand SAF domain
10 PF05130.14 0.98 117 5.0 same-strand FlgN protein
++ More..