Result : B8DRD8
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | CP001197.1 |
| Organism | Desulfovibrio vulgaris (strain Miyazaki F / DSM 19637) |
| Left | 3584404 |
| Right | 3584691 |
| Strand | + |
| Nucleotide Sequence | ATGACCACCATCAGCACCGATCAGGTGGCCGCCATCGCGCGGCTGGCCCGGCTGGCCCCGGACGAGGCGCAGCTTGCAACCTTTGCCCGGCAGTTCGGAGACATCCTGGGATACATGGAGATGCTGAACGGCCTCGACACCACCGGCGTCGAGCCGCTGTACAGCCCCGTGCAGCATGCCACGGCCCTGCGCTCCGACGAAACCGCCCCGCGCTGCACGCGCGAGGATGTGCTGCGGAATGCGCCGGAGGCCGATTCCGAATTCTTCATCGTGCCCAGGATTGTTTAG |
| Sequence | MTTISTDQVAAIARLARLAPDEAQLATFARQFGDILGYMEMLNGLDTTGVEPLYSPVQHATALRSDETAPRCTREDVLRNAPEADSEFFIVPRIV |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
| Pubmed ID | |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | B8DRD8 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 17
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 899505 | 899789 | - | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 2 | 1044737 | 1045000 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 3 | 4371874 | 4372137 | - | NZ_CP039543.1 | Desulfovibrio marinus |
| 4 | 2674562 | 2674816 | + | NZ_CP014229.1 | Desulfovibrio fairfieldensis |
| 5 | 3738167 | 3738430 | + | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 6 | 2526682 | 2526945 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 7 | 470004 | 470288 | - | NZ_AP017378.1 | Desulfovibrio ferrophilus |
| 8 | 4059589 | 4059819 | + | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 9 | 117211 | 117495 | + | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 10 | 1931269 | 1931523 | - | NC_012796.1 | Desulfovibrio magneticus RS-1 |
| 11 | 1797792 | 1798046 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 12 | 1519564 | 1519848 | + | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 13 | 3625847 | 3626101 | - | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 14 | 1710059 | 1710352 | - | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 15 | 2370198 | 2370443 | - | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 16 | 371048 | 371284 | - | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 17 | 3277832 | 3278116 | + | NC_013173.1 | Desulfomicrobium baculatum DSM 4028 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017310.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03054.18 | 0.82 | 14 | 1673.5 | same-strand | tRNA methyl transferase |
| 2 | PF01425.23 | 1.0 | 17 | 28 | same-strand | Amidase |
| 3 | PF00012.22 | 0.94 | 16 | 2232.0 | same-strand | Hsp70 protein |
| 4 | PF01025.21 | 0.82 | 14 | 4365.0 | same-strand | GrpE |
++ More..