Result : B8D124
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | CP001098.1 |
| Organism | Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562) |
| Left | 238779 |
| Right | 239066 |
| Strand | + |
| Nucleotide Sequence | ATGATTAAGAAAGAAGAAGTGGAGAAAATAGCTGGACTTGCCTATCTTAAATTATCAGATGAAGAAAGAGAGACTTTTACCAGGCAACTCGGTGATATTTTAGACTATGTAGAAAAACTAAATGAGCTTGATACTGATGGGGTTGTACCTACTGCTTATACTGTGCCCATGAAGAATGTCCTCAGAGATGATAAAGTAGGTTCATCAATTCCCAGGGAAGAGGCACTTGATAATGCGCCCGACAAAAAGGATGGTCTGTTCAGAGTACCCAGTATCATAGGTGAATAA |
| Sequence | MIKKEEVEKIAGLAYLKLSDEERETFTRQLGDILDYVEKLNELDTDGVVPTAYTVPMKNVLRDDKVGSSIPREEALDNAPDKKDGLFRVPSIIGE |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln). {ECO:0000255|HAMAP-Rule:MF_00122}. |
| Pubmed ID | 19145256 |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | B8D124 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 120
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 238779 | 239066 | + | NC_011899.1 | Halothermothrix orenii H 168 |
| 2 | 2037720 | 2038007 | - | NC_014654.1 | Halanaerobium hydrogeniformans |
| 3 | 2260877 | 2261137 | - | NZ_CP034118.1 | Staphylospora marina |
| 4 | 569354 | 569596 | + | NZ_CP039710.1 | Thermoactinomyces vulgaris |
| 5 | 1759591 | 1759878 | - | NC_017455.1 | Halanaerobium praevalens DSM 2228 |
| 6 | 3153158 | 3153394 | - | NZ_CP048103.1 | Kroppenstedtia eburnea |
| 7 | 183299 | 183589 | + | NZ_CP016379.1 | Anoxybacter fermentans |
| 8 | 5465455 | 5465688 | - | NZ_CP034346.1 | Paenibacillus lutimineralis |
| 9 | 4999804 | 5000061 | - | NC_009483.1 | Geobacter uraniireducens Rf4 |
| 10 | 389884 | 390126 | + | NZ_CP019699.1 | Novibacillus thermophilus |
| 11 | 524696 | 524944 | - | NZ_CP022315.1 | Virgibacillus phasianinus |
| 12 | 93142 | 93429 | - | NC_007517.1 | Geobacter metallireducens GS-15 |
| 13 | 3480783 | 3481031 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 14 | 976747 | 976995 | + | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 15 | 182894 | 183133 | + | NZ_CP017703.1 | Aeribacillus pallidus |
| 16 | 1795041 | 1795274 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 17 | 5188740 | 5188988 | - | NZ_AP019400.1 | Cohnella abietis |
| 18 | 657806 | 658066 | + | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 19 | 2301599 | 2301838 | - | NC_019978.1 | Halobacteroides halobius DSM 5150 |
| 20 | 716158 | 716391 | - | NZ_CP011058.1 | Paenibacillus beijingensis |
| 21 | 2153510 | 2153752 | - | NC_014378.1 | Acetohalobium arabaticum DSM 5501 |
| 22 | 734211 | 734450 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 23 | 3548170 | 3548418 | - | NZ_CP020772.1 | Halobacillus mangrovi |
| 24 | 609738 | 610025 | + | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 25 | 3718972 | 3719229 | - | NC_002939.5 | Geobacter sulfurreducens PCA |
| 26 | 684740 | 684997 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 27 | 642094 | 642351 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 28 | 1721936 | 1722193 | - | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 29 | 584387 | 584644 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 30 | 719464 | 719721 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 31 | 549895 | 550143 | + | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 32 | 631788 | 632054 | + | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 33 | 4167586 | 4167843 | + | NC_011146.1 | Citrifermentans bemidjiense Bem |
| 34 | 718121 | 718360 | + | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 35 | 3256645 | 3256893 | - | NZ_CP011937.1 | Bacillus velezensis |
| 36 | 689653 | 689901 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 37 | 473113 | 473370 | + | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 38 | 2347617 | 2347868 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 39 | 3381577 | 3381834 | + | NZ_CP031092.1 | Salicibibacter kimchii |
| 40 | 2167488 | 2167778 | - | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 41 | 2134964 | 2135221 | - | NZ_CP011361.2 | Salimicrobium jeotgali |
| 42 | 450805 | 451038 | + | NC_011979.1 | Geobacter daltonii FRC-32 |
| 43 | 551541 | 551798 | - | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 44 | 451311 | 451562 | + | NZ_CP048104.1 | Kroppenstedtia pulmonis |
| 45 | 1617457 | 1617687 | + | NC_011830.1 | Desulfitobacterium hafniense DCB-2 |
| 46 | 999423 | 999662 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 47 | 92555 | 92842 | - | NZ_CP009788.1 | Geobacter pickeringii |
| 48 | 204391 | 204624 | + | NZ_CP033433.1 | Cohnella candidum |
| 49 | 939560 | 939805 | + | NZ_CP007032.1 | Desulfitobacterium metallireducens DSM 15288 |
| 50 | 3456020 | 3456277 | + | NZ_CP035485.1 | Salicibibacter halophilus |
| 51 | 4068443 | 4068700 | + | NZ_AP023213.1 | Citrifermentans bremense |
| 52 | 4964716 | 4964949 | - | NZ_CP013023.1 | Paenibacillus bovis |
| 53 | 308489 | 308728 | + | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 54 | 610194 | 610451 | + | NZ_CP029797.1 | Paraliobacillus zengyii |
| 55 | 1879318 | 1879575 | + | NZ_CP034248.1 | Paenibacillus lentus |
| 56 | 945129 | 945416 | + | NC_015520.1 | Mahella australiensis 50-1 BON |
| 57 | 1059483 | 1059770 | + | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 58 | 3462722 | 3462970 | - | NZ_CP013652.1 | Paenibacillus naphthalenovorans |
| 59 | 55131 | 55421 | + | NZ_CP018866.1 | Sutcliffiella cohnii |
| 60 | 2670026 | 2670298 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 61 | 3152366 | 3152653 | - | NZ_CP015519.1 | Syntrophotalea acetylenivorans |
| 62 | 183522 | 183761 | - | NZ_CP070511.1 | Parageobacillus toebii |
| 63 | 1302921 | 1303172 | + | NC_018068.1 | Desulfosporosinus acidiphilus SJ4 |
| 64 | 455947 | 456213 | + | NZ_CP010311.1 | Geoalkalibacter subterraneus |
| 65 | 693192 | 693482 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 66 | 683775 | 684032 | - | NZ_CP010802.1 | Desulfuromonas soudanensis |
| 67 | 3677262 | 3677501 | - | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 68 | 2736745 | 2736984 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 69 | 4048322 | 4048570 | - | NZ_CP022437.1 | Virgibacillus necropolis |
| 70 | 3167552 | 3167803 | - | NC_018515.1 | Desulfosporosinus meridiei DSM 13257 |
| 71 | 695761 | 696051 | + | NZ_CP053989.1 | Niallia circulans |
| 72 | 569135 | 569383 | + | NZ_CP008876.1 | Terribacillus goriensis |
| 73 | 3880814 | 3881104 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 74 | 571234 | 571524 | + | NZ_CP041666.1 | Radiobacillus deserti |
| 75 | 2404627 | 2404866 | + | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 76 | 1034085 | 1034333 | + | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 77 | 3047483 | 3047740 | - | NC_019897.1 | Thermobacillus composti KWC4 |
| 78 | 6312360 | 6312617 | - | NZ_CP034437.1 | Paenibacillus albus |
| 79 | 4028023 | 4028274 | - | NC_016584.1 | Desulfosporosinus orientis DSM 765 |
| 80 | 2527968 | 2528201 | + | NC_007498.2 | Syntrophotalea carbinolica DSM 2380 |
| 81 | 2084303 | 2084590 | - | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 82 | 1992960 | 1993250 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 83 | 986358 | 986648 | - | NZ_AP013035.1 | Thermosulfidibacter takaii ABI70S6 |
| 84 | 1428209 | 1428439 | + | NC_018017.1 | Desulfitobacterium dehalogenans ATCC 51507 |
| 85 | 1675772 | 1676047 | - | NZ_CP041217.1 | Saccharibacillus brassicae |
| 86 | 2245720 | 2245983 | - | NZ_CP046996.1 | Dehalobacter restrictus |
| 87 | 5929975 | 5930232 | - | NZ_CP009428.1 | Paenibacillus odorifer |
| 88 | 774216 | 774503 | + | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 89 | 697244 | 697492 | + | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 90 | 7170844 | 7171101 | - | NZ_CP009285.1 | Paenibacillus borealis |
| 91 | 5693287 | 5693544 | - | NZ_CP048209.1 | Paenibacillus lycopersici |
| 92 | 2976100 | 2976339 | - | NZ_CP012024.1 | Bacillus smithii |
| 93 | 698664 | 698921 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 94 | 4795508 | 4795765 | + | NZ_CP048286.1 | Paenibacillus rhizovicinus |
| 95 | 3376335 | 3376601 | + | NC_008609.1 | Pelobacter propionicus DSM 2379 |
| 96 | 4199851 | 4200084 | + | NZ_CP016809.1 | Paenibacillus ihbetae |
| 97 | 2103001 | 2103255 | - | NZ_CP017237.1 | Moorella thermoacetica |
| 98 | 713950 | 714195 | + | NC_015172.1 | Syntrophobotulus glycolicus DSM 8271 |
| 99 | 1980080 | 1980376 | + | NC_013939.1 | Deferribacter desulfuricans SSM1 |
| 100 | 404943 | 405233 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 101 | 1300798 | 1301028 | + | NC_019903.1 | Desulfitobacterium dichloroeliminans LMG P-21439 |
| 102 | 6801406 | 6801654 | + | NZ_AP019308.1 | Paenibacillus baekrokdamisoli |
| 103 | 816017 | 816283 | + | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 104 | 1017989 | 1018291 | + | NC_011297.1 | Dictyoglomus thermophilum H-6-12 |
| 105 | 74027 | 74317 | - | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 106 | 9291321 | 9291575 | - | NC_013440.1 | Haliangium ochraceum DSM 14365 |
| 107 | 6583062 | 6583337 | + | NZ_CP045293.1 | Paenibacillus guangzhouensis |
| 108 | 3409430 | 3409687 | + | NC_010814.1 | Geobacter lovleyi SZ |
| 109 | 4011951 | 4012241 | - | NZ_AP017312.1 | Aneurinibacillus soli |
| 110 | 3991314 | 3991562 | - | NZ_LT828648.1 | Nitrospira japonica |
| 111 | 2201107 | 2201394 | - | NZ_CP017305.1 | Chlorobaculum limnaeum |
| 112 | 603102 | 603344 | - | NZ_CP042909.1 | Thermosulfurimonas marina |
| 113 | 2251106 | 2251393 | - | NC_010803.1 | Chlorobium limicola DSM 245 |
| 114 | 2552901 | 2553194 | - | NZ_CP040058.1 | Anaerostipes rhamnosivorans |
| 115 | 347543 | 347830 | + | NC_007512.1 | Pelodictyon luteolum DSM 273 |
| 116 | 5652832 | 5653131 | - | NZ_CP036275.1 | Maioricimonas rarisocia |
| 117 | 3241014 | 3241247 | - | NZ_CP011801.1 | Nitrospira moscoviensis |
| 118 | 2561295 | 2561576 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 119 | 864987 | 865268 | + | NC_008148.1 | Rubrobacter xylanophilus DSM 9941 |
| 120 | 2041442 | 2041723 | - | NZ_CP031115.1 | Rubrobacter indicoceani |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011899.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01425.23 | 0.97 | 116 | 17.0 | same-strand | Amidase |
| 2 | PF02934.17 | 0.94 | 113 | 1488 | same-strand | GatB/GatE catalytic domain |
| 3 | PF02637.20 | 0.94 | 113 | 1488 | same-strand | GatB domain |
++ More..