Result : EXP02858
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02858 |
| NCBI Accession ID | |
| Organism | Faecalibacterium,Clostridium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | GTGGTAGCTGTACTTGAAGCTATGAAGATGGAAAATGATATCGTAGCACTTGAGGACGGTACAATTGCAAGTATAAATGTAAATGTTGGAGACAGTGTTGAAACTAATCAAACTCTTGTAACAATCAACTAA |
| Sequence | MVAVLEAMKMENDIVALEDGTIASINVNVGDSVETNQTLVTIN |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 43 |
++ More..
| Conservation Analysis |
No. of Species: 500
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1674552 | 1674662 | - | NZ_CP032364.1 | Lachnoanaerobaculum umeaense |
| 2 | 859484 | 859594 | + | NZ_CP022464.2 | Enterocloster bolteae |
| 3 | 1428000 | 1428122 | + | NC_014376.1 | [Clostridium] saccharolyticum WM1 |
| 4 | 2495099 | 2495209 | - | NC_015275.1 | Cellulosilyticum lentocellum DSM 5427 |
| 5 | 1203469 | 1203579 | + | NZ_LN879430.1 | Herbinix luporum |
| 6 | 9211 | 9321 | + | NZ_CP070062.1 | Coprococcus comes |
| 7 | 3747988 | 3748098 | + | NZ_CP048000.1 | Anaerocolumna sedimenticola |
| 8 | 1385891 | 1386001 | + | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 9 | 937873 | 937983 | + | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
| 10 | 140817 | 140927 | - | NZ_CP040638.1 | Natrinema pallidum |
| 11 | 317945 | 318055 | + | NC_022795.1 | Pseudothermotoga hypogea DSM 11164 = NBRC 106472 |
| 12 | 1686946 | 1687056 | - | NZ_LT635479.1 | Lachnoclostridium phocaeense |
| 13 | 2862134 | 2862244 | + | NC_019962.1 | Natrinema pellirubrum DSM 15624 |
| 14 | 2479332 | 2479442 | - | NC_019962.1 | Natrinema pellirubrum DSM 15624 |
| 15 | 2639079 | 2639189 | + | NZ_CP039126.1 | Blautia producta |
| 16 | 3248850 | 3248960 | - | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 17 | 962750 | 962860 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 18 | 292699 | 292809 | - | NC_015707.1 | Pseudothermotoga thermarum DSM 5069 |
| 19 | 3136999 | 3137109 | - | NZ_CP036170.1 | [Clostridium] scindens ATCC 35704 |
| 20 | 344557 | 344688 | + | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 21 | 2365789 | 2365899 | - | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 22 | 1829351 | 1829461 | - | NZ_LR699011.1 | Roseburia hominis |
| 23 | 1425405 | 1425515 | + | NZ_CP036422.1 | Halioglobus maricola |
| 24 | 132210 | 132320 | - | NZ_LR134506.1 | Porphyromonas cangingivalis |
| 25 | 727743 | 727853 | - | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 26 | 1346445 | 1346555 | + | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 27 | 1691026 | 1691136 | - | NZ_CP014334.1 | Fervidobacterium islandicum |
| 28 | 1837857 | 1837967 | - | NZ_CP025197.1 | Acetivibrio saccincola |
| 29 | 2291411 | 2291518 | - | NZ_LR027880.1 | Roseburia intestinalis L1-82 |
| 30 | 376749 | 376859 | - | NC_015216.1 | Methanobacterium lacus |
| 31 | 66769 | 66879 | + | NZ_AP019822.1 | Pseudoleptotrichia goodfellowii |
| 32 | 1967348 | 1967458 | - | NC_017455.1 | Halanaerobium praevalens DSM 2228 |
| 33 | 50342 | 50452 | - | NZ_CP013336.1 | Fusobacterium hwasookii ChDC F206 |
| 34 | 2141008 | 2141118 | + | NZ_LT906443.1 | Corynebacterium ulcerans |
| 35 | 2075981 | 2076091 | - | NZ_CP030280.1 | Blautia argi |
| 36 | 2271862 | 2271972 | - | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 37 | 1223770 | 1223880 | + | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 38 | 1785952 | 1786062 | - | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 39 | 70109 | 70219 | + | NZ_AP014510.1 | Thermotoga profunda AZM34c06 |
| 40 | 333936 | 334046 | - | NZ_CP024699.1 | Fusobacterium pseudoperiodonticum |
| 41 | 216960 | 217067 | - | NC_006397.1 | Haloarcula marismortui ATCC 43049 |
| 42 | 328564 | 328674 | - | NZ_AP014509.1 | Thermotoga caldifontis AZM44c09 |
| 43 | 42586 | 42693 | - | NZ_CP019155.1 | Haloarcula taiwanensis |
| 44 | 3280408 | 3280518 | - | NZ_LR215729.2 | Pseudomonas marincola |
| 45 | 603046 | 603156 | + | NC_017301.2 | Corynebacterium pseudotuberculosis C231 |
| 46 | 1131947 | 1132057 | - | NZ_CP018153.1 | Gramella salexigens |
| 47 | 467258 | 467368 | - | NZ_AP017558.1 | Halopenitus persicus |
| 48 | 821229 | 821339 | - | NZ_CP068168.1 | Corynebacterium amycolatum |
| 49 | 689873 | 689983 | + | NZ_CP033896.1 | Corynebacterium choanae |
| 50 | 857979 | 858089 | - | NC_013849.1 | Ferroglobus placidus DSM 10642 |
| 51 | 2193488 | 2193598 | + | NC_017857.3 | Methylophaga nitratireducenticrescens |
| 52 | 2168612 | 2168743 | - | NC_013922.1 | Natrialba magadii ATCC 43099 |
| 53 | 3200601 | 3200711 | + | NC_013922.1 | Natrialba magadii ATCC 43099 |
| 54 | 647830 | 647940 | + | NZ_LN831027.1 | Fusobacterium nucleatum subsp. polymorphum |
| 55 | 2120016 | 2120126 | + | NZ_CP058670.1 | Chryseoglobus indicus |
| 56 | 448527 | 448637 | - | NC_022438.1 | Leifsonia xyli subsp. cynodontis DSM 46306 |
| 57 | 1500929 | 1501039 | + | NZ_CP017768.1 | Methanobacterium subterraneum |
| 58 | 168833 | 168943 | - | NC_022792.1 | Pseudothermotoga elfii DSM 9442 = NBRC 107921 |
| 59 | 177593 | 177703 | - | NC_009828.1 | Pseudothermotoga lettingae TMO |
| 60 | 1723392 | 1723502 | + | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 61 | 748197 | 748307 | + | NZ_CP068114.1 | Fusobacterium canifelinum |
| 62 | 622692 | 622802 | + | NZ_CP033897.1 | Corynebacterium gerontici |
| 63 | 2989885 | 2989995 | - | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 64 | 3147923 | 3148033 | + | NZ_CP053923.1 | Defluviicoccus vanus |
| 65 | 444539 | 444649 | + | NZ_AP022847.1 | Nitrosophilus alvini |
| 66 | 9167611 | 9167739 | + | NC_013440.1 | Haliangium ochraceum DSM 14365 |
| 67 | 3189435 | 3189560 | - | NZ_CP054301.1 | Marinomonas primoryensis |
| 68 | 1263866 | 1263973 | + | NZ_CP009240.1 | Megasphaera elsdenii 14-14 |
| 69 | 5164340 | 5164447 | - | NZ_CP025791.1 | Flavivirga eckloniae |
| 70 | 1192494 | 1192604 | + | NC_020134.1 | Thermoclostridium stercorarium subsp. stercorarium DSM 8532 |
| 71 | 1484391 | 1484501 | + | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 72 | 142053 | 142196 | + | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 73 | 2574405 | 2574515 | - | NZ_CP012946.1 | Blastochloris viridis |
| 74 | 1762717 | 1762827 | - | NZ_CP033898.1 | Corynebacterium pseudopelargi |
| 75 | 1263492 | 1263617 | - | NZ_CP070273.1 | Marinomonas foliarum |
| 76 | 1764128 | 1764238 | - | NZ_CP035299.1 | Corynebacterium pelargi |
| 77 | 2033778 | 2033888 | - | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 78 | 227869 | 227979 | - | NZ_LT990039.1 | Massilistercora timonensis |
| 79 | 4171227 | 4171334 | + | NZ_CP036292.1 | Rosistilla oblonga |
| 80 | 3705041 | 3705148 | - | NZ_CP061081.1 | Marinomonas arctica |
| 81 | 458683 | 458790 | - | NZ_CP029462.1 | Megasphaera stantonii |
| 82 | 1701224 | 1701334 | - | NZ_LR594050.1 | Streptococcus porcinus |
| 83 | 933833 | 933943 | + | NZ_CP015101.1 | Thermococcus barossii |
| 84 | 152191 | 152301 | - | NZ_CP015101.1 | Thermococcus barossii |
| 85 | 2132728 | 2132838 | - | NZ_CP031217.1 | Halarcobacter bivalviorum |
| 86 | 1322196 | 1322306 | - | NZ_CP031217.1 | Halarcobacter bivalviorum |
| 87 | 3282929 | 3283039 | + | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 88 | 1793452 | 1793577 | + | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 89 | 1045920 | 1046030 | + | NZ_CP015106.1 | Thermococcus radiotolerans |
| 90 | 261939 | 262049 | - | NZ_CP015106.1 | Thermococcus radiotolerans |
| 91 | 1524724 | 1524834 | + | NC_014387.1 | Butyrivibrio proteoclasticus B316 |
| 92 | 665088 | 665198 | + | NZ_LN831026.1 | Corynebacterium diphtheriae |
| 93 | 1740145 | 1740252 | + | NZ_CP012047.1 | Tetragenococcus halophilus |
| 94 | 1799303 | 1799410 | - | NC_018010.1 | Belliella baltica DSM 15883 |
| 95 | 56835 | 56942 | + | NZ_CP073368.1 | Haloarcula sinaiiensis ATCC 33800 |
| 96 | 2034910 | 2035017 | - | NC_013740.1 | Acidaminococcus fermentans DSM 20731 |
| 97 | 371489 | 371599 | - | NC_014658.1 | Methanothermus fervidus DSM 2088 |
| 98 | 3647615 | 3647743 | + | NZ_LR215980.1 | Paraprevotella xylaniphila YIT 11841 |
| 99 | 1728545 | 1728673 | - | NC_018015.1 | Thermococcus cleftensis |
| 100 | 601245 | 601355 | + | NC_018015.1 | Thermococcus cleftensis |
| 101 | 76874 | 76996 | + | NC_014804.1 | Thermococcus barophilus MP |
| 102 | 241688 | 241810 | - | NC_014804.1 | Thermococcus barophilus MP |
| 103 | 4862864 | 4862989 | + | NZ_CP060783.1 | Diaphorobacter aerolatus |
| 104 | 1986705 | 1986836 | + | NZ_LN734822.1 | Methanobacterium formicicum |
| 105 | 1666729 | 1666839 | + | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 106 | 227633 | 227743 | + | NZ_CP012362.1 | Oblitimonas alkaliphila |
| 107 | 1342571 | 1342681 | - | NZ_LR698975.1 | Methanosphaera stadtmanae |
| 108 | 2861226 | 2861357 | - | NZ_CP034940.1 | Halorubrum ezzemoulense |
| 109 | 368182 | 368289 | - | NC_015943.1 | Haloarcula hispanica ATCC 33960 |
| 110 | 3630414 | 3630527 | + | NZ_CP036250.1 | Egicoccus halophilus |
| 111 | 2143343 | 2143453 | + | NC_014041.1 | Zunongwangia profunda SM-A87 |
| 112 | 269839 | 269970 | - | NZ_LR130778.1 | Petrocella atlantisensis |
| 113 | 3573917 | 3574024 | - | NC_014759.1 | Marivirga tractuosa DSM 4126 |
| 114 | 1321945 | 1322055 | - | NZ_CP011308.1 | Sulfurovum lithotrophicum |
| 115 | 2057051 | 2057158 | + | NZ_CP030041.1 | Echinicola strongylocentroti |
| 116 | 1283232 | 1283339 | - | NZ_LT906439.1 | Streptococcus merionis |
| 117 | 2070796 | 2070906 | - | NC_007426.1 | Natronomonas pharaonis DSM 2160 |
| 118 | 3134660 | 3134770 | + | NZ_CP019400.1 | Acidipropionibacterium acidipropionici |
| 119 | 2389285 | 2389419 | + | NZ_CP019400.1 | Acidipropionibacterium acidipropionici |
| 120 | 186222 | 186344 | + | NZ_CP006965.1 | Thermococcus paralvinellae |
| 121 | 343115 | 343237 | - | NZ_CP006965.1 | Thermococcus paralvinellae |
| 122 | 2137481 | 2137591 | - | NZ_AP019846.1 | Leptotrichia hongkongensis |
| 123 | 2274946 | 2275077 | + | NC_020388.1 | Natronomonas moolapensis 8.8.11 |
| 124 | 1342981 | 1343091 | + | NZ_CP014150.1 | Paeniclostridium sordellii |
| 125 | 2597088 | 2597198 | - | NZ_CP014150.1 | Paeniclostridium sordellii |
| 126 | 748693 | 748803 | - | NZ_CP014150.1 | Paeniclostridium sordellii |
| 127 | 34369 | 34479 | - | NC_011529.1 | Thermococcus onnurineus NA1 |
| 128 | 836080 | 836190 | + | NC_011529.1 | Thermococcus onnurineus NA1 |
| 129 | 2085300 | 2085410 | - | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 130 | 1444674 | 1444784 | - | NZ_CP007773.1 | Campylobacter subantarcticus LMG 24377 |
| 131 | 892828 | 892938 | + | NZ_CP063164.1 | Sulfurovum indicum |
| 132 | 2098572 | 2098682 | - | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 133 | 1332989 | 1333099 | - | NZ_CP025536.1 | Streptococcus pluranimalium |
| 134 | 2018007 | 2018117 | - | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 135 | 373372 | 373482 | - | NZ_LR881183.1 | Thermococcus camini |
| 136 | 1226982 | 1227092 | + | NZ_LR881183.1 | Thermococcus camini |
| 137 | 509780 | 509890 | - | NZ_CP040846.1 | Thermococcus indicus |
| 138 | 1184986 | 1185114 | - | NZ_CP040846.1 | Thermococcus indicus |
| 139 | 541984 | 542094 | + | NZ_CP014854.1 | Thermococcus celer Vu 13 = JCM 8558 |
| 140 | 176509 | 176631 | + | NZ_CP014854.1 | Thermococcus celer Vu 13 = JCM 8558 |
| 141 | 1303092 | 1303223 | + | NC_014297.1 | Halalkalicoccus jeotgali B3 |
| 142 | 86625 | 86735 | - | NZ_CP058334.1 | Natronomonas halophila |
| 143 | 630225 | 630335 | - | NZ_CP058334.1 | Natronomonas halophila |
| 144 | 2706593 | 2706703 | - | NZ_CP051183.1 | Bermanella marisrubri |
| 145 | 403221 | 403331 | - | NZ_CP006944.1 | Mannheimia varigena USDA-ARS-USMARC-1312 |
| 146 | 1294455 | 1294565 | - | NZ_LT906446.1 | Megamonas hypermegale |
| 147 | 928068 | 928175 | + | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 148 | 4906327 | 4906437 | + | NC_011768.1 | Desulfatibacillum aliphaticivorans |
| 149 | 1614736 | 1614846 | - | NC_014762.1 | Sulfuricurvum kujiense DSM 16994 |
| 150 | 2135294 | 2135404 | - | NZ_CP011039.1 | Pseudoalteromonas spongiae UST010723-006 |
| 151 | 701662 | 701772 | - | NZ_CP015102.1 | Thermococcus pacificus |
| 152 | 1531613 | 1531723 | + | NZ_CP015102.1 | Thermococcus pacificus |
| 153 | 1866957 | 1867067 | - | NC_006512.1 | Idiomarina loihiensis L2TR |
| 154 | 2887580 | 2887690 | + | NZ_CP028136.1 | Gramella fulva |
| 155 | 708526 | 708636 | + | NZ_LR738855.1 | Corynebacterium rouxii |
| 156 | 276566 | 276676 | - | NZ_CP063079.1 | Campylobacter peloridis |
| 157 | 816979 | 817089 | + | NZ_CP004353.1 | Corynebacterium vitaeruminis DSM 20294 |
| 158 | 227493 | 227603 | + | NC_012883.1 | Thermococcus sibiricus MM 739 |
| 159 | 1380125 | 1380235 | + | NC_012883.1 | Thermococcus sibiricus MM 739 |
| 160 | 1424033 | 1424158 | + | NZ_CP017812.1 | Boudabousia tangfeifanii |
| 161 | 891214 | 891324 | + | NZ_CP011542.1 | Corynebacterium mustelae |
| 162 | 432621 | 432731 | - | NZ_CP014862.1 | Thermococcus profundus |
| 163 | 1825788 | 1825898 | + | NZ_CP014862.1 | Thermococcus profundus |
| 164 | 1505819 | 1505929 | - | NZ_AP022826.1 | Nitrosophilus labii |
| 165 | 864686 | 864796 | - | NZ_CP015103.1 | Thermococcus siculi |
| 166 | 1748863 | 1748973 | + | NZ_CP015103.1 | Thermococcus siculi |
| 167 | 898993 | 899121 | - | NC_009515.1 | Methanobrevibacter smithii ATCC 35061 |
| 168 | 2210482 | 2210592 | - | NC_008212.1 | Haloquadratum walsbyi DSM 16790 |
| 169 | 1627935 | 1628066 | - | NZ_CP011564.1 | Halanaeroarchaeum sulfurireducens |
| 170 | 4648211 | 4648321 | - | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 171 | 3271049 | 3271159 | - | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 172 | 2712917 | 2713027 | - | NZ_CP025198.1 | Acidipropionibacterium virtanenii |
| 173 | 426366 | 426491 | + | NC_022198.1 | Corynebacterium argentoratense DSM 44202 |
| 174 | 2768325 | 2768435 | + | NZ_CP020715.1 | Cnuibacter physcomitrellae |
| 175 | 485046 | 485156 | - | NC_015680.1 | Pyrococcus yayanosii CH1 |
| 176 | 1016881 | 1016988 | - | NC_017096.1 | Caldisericum exile AZM16c01 |
| 177 | 1463591 | 1463701 | - | NZ_CP069485.1 | Corynebacterium glucuronolyticum |
| 178 | 715397 | 715507 | + | NZ_LT632322.1 | Murdochiella vaginalis |
| 179 | 1620288 | 1620404 | + | NZ_CP014265.1 | Methanobrevibacter olleyae |
| 180 | 1355425 | 1355535 | + | NC_015519.1 | Tepidanaerobacter acetatoxydans Re1 |
| 181 | 3150838 | 3150948 | - | NZ_CP025938.1 | Tamlana carrageenivorans |
| 182 | 1265687 | 1265818 | - | NZ_CP045488.1 | Natronorubrum aibiense |
| 183 | 3112111 | 3112221 | + | NZ_CP045488.1 | Natronorubrum aibiense |
| 184 | 1674773 | 1674883 | - | NC_017095.1 | Fervidobacterium pennivorans DSM 9078 |
| 185 | 2074794 | 2074904 | - | NC_009464.1 | Methanocella arvoryzae MRE50 |
| 186 | 1038929 | 1039060 | - | NC_014729.1 | Halogeometricum borinquense DSM 11551 |
| 187 | 5348465 | 5348584 | - | NC_007645.1 | Hahella chejuensis KCTC 2396 |
| 188 | 421544 | 421654 | + | NZ_CP042997.1 | Aquisphaera giovannonii |
| 189 | 1086261 | 1086383 | - | NZ_CP007055.1 | Halostagnicola larsenii XH-48 |
| 190 | 2653548 | 2653691 | + | NZ_CP037867.1 | Hydrogenophaga pseudoflava |
| 191 | 138869 | 138979 | + | NZ_CP039712.1 | Vagococcus zengguangii |
| 192 | 177595 | 177705 | + | NC_013665.1 | Methanocella paludicola SANAE |
| 193 | 1894081 | 1894212 | - | NC_019964.1 | Halovivax ruber XH-70 |
| 194 | 710656 | 710778 | - | NZ_CP007453.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 195 | 996270 | 996380 | - | NZ_CP028103.1 | Fusobacterium varium ATCC 27725 |
| 196 | 2447269 | 2447379 | + | NZ_CP010429.1 | Spirosoma radiotolerans |
| 197 | 2144261 | 2144371 | + | NZ_CP012938.1 | Bacteroides ovatus |
| 198 | 2430160 | 2430276 | + | NC_013790.1 | Methanobrevibacter ruminantium M1 |
| 199 | 1574924 | 1575046 | + | NZ_CP004387.1 | Alcanivorax pacificus W11-5 |
| 200 | 1075857 | 1075967 | - | NZ_CP028926.1 | Pasteurella multocida |
| 201 | 1826206 | 1826316 | + | NZ_AP019779.1 | Methanobrevibacter arboriphilus |
| 202 | 1704749 | 1704871 | - | NZ_LN831302.1 | Halobacterium hubeiense |
| 203 | 1376132 | 1376242 | - | NZ_CP031305.1 | Natronorubrum bangense |
| 204 | 3020358 | 3020468 | + | NZ_CP031305.1 | Natronorubrum bangense |
| 205 | 3012816 | 3012926 | - | NZ_CP022121.1 | Dehalobacterium formicoaceticum |
| 206 | 1561176 | 1561286 | - | NZ_CP041070.1 | Arcobacter anaerophilus |
| 207 | 1759191 | 1759319 | - | NZ_CP061799.1 | Desulfonema limicola |
| 208 | 1284071 | 1284181 | + | NZ_CP060715.1 | Erysipelothrix inopinata |
| 209 | 4453578 | 4453688 | + | NZ_CP058909.1 | Halosimplex pelagicum |
| 210 | 1929541 | 1929663 | + | NC_012804.1 | Thermococcus gammatolerans EJ3 |
| 211 | 1691684 | 1691806 | - | NC_012804.1 | Thermococcus gammatolerans EJ3 |
| 212 | 2325727 | 2325837 | - | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 213 | 3186644 | 3186766 | + | NZ_CP016359.1 | Gramella flava JLT2011 |
| 214 | 822937 | 823047 | - | NZ_CP061280.1 | Mannheimia bovis |
| 215 | 570067 | 570180 | + | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 216 | 2397758 | 2397868 | + | NZ_CP044231.1 | Microbacterium caowuchunii |
| 217 | 4792458 | 4792568 | - | NZ_CP025096.1 | Spirosoma pollinicola |
| 218 | 1880277 | 1880387 | - | NZ_CP036275.1 | Maioricimonas rarisocia |
| 219 | 1824109 | 1824231 | + | NZ_CP007264.1 | Thermococcus nautili |
| 220 | 740104 | 740232 | - | NZ_CP007264.1 | Thermococcus nautili |
| 221 | 2177840 | 2177950 | - | NC_006085.1 | Cutibacterium acnes KPA171202 |
| 222 | 2254907 | 2255017 | + | NZ_CP040637.1 | Natrinema pallidum |
| 223 | 1937366 | 1937476 | + | NC_016751.1 | Marinitoga piezophila KA3 |
| 224 | 1674524 | 1674637 | - | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 225 | 153162 | 153290 | - | NZ_CP015402.2 | Muribaculum intestinale |
| 226 | 485968 | 486078 | - | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |
| 227 | 757772 | 757903 | + | NC_017034.1 | Methanocella conradii HZ254 |
| 228 | 2556074 | 2556184 | - | NZ_CP032624.1 | Gryllotalpicola protaetiae |
| 229 | 3671322 | 3671429 | + | NZ_CP019646.1 | Limihaloglobus sulfuriphilus |
| 230 | 4168535 | 4168657 | + | NZ_CP040812.1 | Antarcticibacterium flavum |
| 231 | 3657365 | 3657475 | + | NZ_CP069450.1 | Butyricimonas virosa |
| 232 | 5661900 | 5662010 | + | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 233 | 207751 | 207861 | + | NZ_CP046531.1 | Mannheimia ovis |
| 234 | 2042670 | 2042798 | + | NC_011901.1 | Thioalkalivibrio sulfidiphilus HL-EbGr7 |
| 235 | 209171 | 209281 | + | NC_021064.1 | Cutibacterium avidum 44067 |
| 236 | 1616180 | 1616302 | + | NC_007512.1 | Pelodictyon luteolum DSM 273 |
| 237 | 365298 | 365408 | + | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 238 | 887112 | 887234 | + | NZ_CP008887.1 | Thermococcus eurythermalis |
| 239 | 1827843 | 1827965 | - | NZ_CP008887.1 | Thermococcus eurythermalis |
| 240 | 2118277 | 2118387 | + | NC_015574.1 | Methanobacterium paludis |
| 241 | 3053794 | 3053904 | - | NZ_CP039456.1 | Changchengzhania lutea |
| 242 | 1906618 | 1906728 | - | NZ_CP011312.1 | Corynebacterium kutscheri |
| 243 | 1574937 | 1575059 | - | NZ_CP021081.1 | Deinococcus ficus |
| 244 | 285069 | 285179 | + | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 245 | 2907325 | 2907435 | + | NZ_CP015401.2 | Bacteroides caecimuris |
| 246 | 4654452 | 4654559 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 247 | 1425909 | 1426019 | + | NC_009718.1 | Fervidobacterium nodosum Rt17-B1 |
| 248 | 1239860 | 1239970 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 249 | 373701 | 373811 | + | NZ_AP023049.1 | Alistipes indistinctus |
| 250 | 1411320 | 1411430 | - | NC_019974.1 | Natronococcus occultus SP4 |
| 251 | 4690131 | 4690259 | - | NZ_CP061800.1 | Desulfonema magnum |
| 252 | 756990 | 757112 | + | NZ_CP009245.1 | Corynebacterium aquilae DSM 44791 |
| 253 | 1772946 | 1773056 | + | NZ_AP019781.1 | Methanoculleus chikugoensis |
| 254 | 585018 | 585128 | - | NZ_CP071463.1 | Haloterrigena longa |
| 255 | 423906 | 424016 | - | NZ_CP029354.1 | Azospirillum thermophilum |
| 256 | 913076 | 913186 | - | NZ_CP014835.1 | Streptococcus halotolerans |
| 257 | 2469366 | 2469479 | - | NC_014230.1 | Croceibacter atlanticus HTCC2559 |
| 258 | 1151128 | 1151238 | - | NC_012039.1 | Campylobacter lari RM2100 |
| 259 | 1379152 | 1379274 | - | NZ_CP042476.1 | Antarcticibacterium arcticum |
| 260 | 3784493 | 3784603 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 261 | 1834008 | 1834118 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 262 | 1167100 | 1167210 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 263 | 1320469 | 1320600 | + | NC_006177.1 | Symbiobacterium thermophilum IAM 14863 |
| 264 | 1013414 | 1013524 | - | NZ_AP014612.1 | Streptococcus troglodytae |
| 265 | 3126705 | 3126836 | - | NZ_CP034345.1 | Haloplanus rallus |
| 266 | 585802 | 585912 | + | NZ_CP007140.1 | Thermococcus guaymasensis DSM 11113 |
| 267 | 303744 | 303866 | - | NZ_CP007140.1 | Thermococcus guaymasensis DSM 11113 |
| 268 | 1472263 | 1472373 | - | NZ_CP028106.1 | Fusobacterium gonidiaformans ATCC 25563 |
| 269 | 1022380 | 1022490 | + | NZ_CP028106.1 | Fusobacterium gonidiaformans ATCC 25563 |
| 270 | 42071 | 42181 | - | NZ_AP019845.1 | Leptotrichia trevisanii |
| 271 | 1367871 | 1367999 | - | NZ_AP014879.1 | Sulfuricaulis limicola |
| 272 | 2529929 | 2530039 | + | NZ_CP029463.1 | Flavobacterium sediminis |
| 273 | 2644987 | 2645109 | - | NZ_CP019240.1 | Rhodoferax antarcticus |
| 274 | 443803 | 443913 | - | NZ_CP040635.1 | Acidipropionibacterium jensenii |
| 275 | 1564913 | 1565023 | - | NZ_CP053836.1 | Halarcobacter ebronensis |
| 276 | 2768298 | 2768408 | + | NZ_CP031415.1 | Saccharospirillum mangrovi |
| 277 | 550164 | 550274 | + | NC_010729.1 | Porphyromonas gingivalis ATCC 33277 |
| 278 | 2817187 | 2817297 | - | NZ_AP019735.1 | Alistipes communis |
| 279 | 2123410 | 2123520 | - | NC_014933.1 | Bacteroides helcogenes P 36-108 |
| 280 | 2261999 | 2262109 | - | NZ_AP022822.1 | Enterococcus saigonensis |
| 281 | 4177142 | 4177249 | + | NZ_CP020105.1 | Spirosoma rigui |
| 282 | 1430984 | 1431094 | + | NC_006624.1 | Thermococcus kodakarensis KOD1 |
| 283 | 868204 | 868314 | + | NC_006624.1 | Thermococcus kodakarensis KOD1 |
| 284 | 3841260 | 3841367 | - | NZ_CP061941.1 | Marinomonas algicola |
| 285 | 2143076 | 2143186 | - | NZ_CP017713.1 | Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167 = DSM 20001 |
| 286 | 1617987 | 1618097 | + | NC_007947.1 | Methylobacillus flagellatus KT |
| 287 | 2456159 | 2456269 | + | NC_017583.1 | Spirochaeta thermophila DSM 6578 |
| 288 | 730982 | 731092 | + | NZ_CP029256.1 | Christensenella minuta |
| 289 | 1027395 | 1027505 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 290 | 3420986 | 3421108 | - | NZ_CP040924.1 | Clostridium thermarum |
| 291 | 1336160 | 1336270 | + | NZ_HF545616.1 | Ruminococcus bicirculans |
| 292 | 1925408 | 1925536 | + | NZ_AP014936.1 | Sulfurifustis variabilis |
| 293 | 6325667 | 6325777 | - | NZ_CP011125.1 | Sandaracinus amylolyticus |
| 294 | 1029100 | 1029210 | + | NZ_CP040463.1 | Caminibacter mediatlanticus TB-2 |
| 295 | 1328346 | 1328456 | - | NZ_CP014750.1 | Thermococcus peptonophilus |
| 296 | 336992 | 337102 | - | NZ_CP030104.1 | Flagellimonas maritima |
| 297 | 1039707 | 1039817 | + | NC_008571.1 | Gramella forsetii KT0803 |
| 298 | 1506334 | 1506450 | + | NC_015635.1 | Microlunatus phosphovorus NM-1 |
| 299 | 956794 | 956904 | - | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 300 | 640825 | 640935 | + | NZ_LT900021.1 | Thermococcus henrietii |
| 301 | 2081699 | 2081824 | - | NC_017856.1 | Methylophaga frappieri |
| 302 | 428445 | 428555 | - | NZ_CP049889.1 | Jeotgalibaca porci |
| 303 | 785008 | 785115 | - | NZ_CP049889.1 | Jeotgalibaca porci |
| 304 | 1658015 | 1658125 | - | NC_011060.1 | Pelodictyon phaeoclathratiforme BU-1 |
| 305 | 2089200 | 2089322 | - | NC_018024.1 | Acetomicrobium mobile DSM 13181 |
| 306 | 197661 | 197771 | - | NZ_CP032819.1 | Butyricimonas faecalis |
| 307 | 3573253 | 3573363 | + | NZ_LN877293.1 | Bacteroides fragilis |
| 308 | 2575463 | 2575588 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 309 | 545959 | 546069 | + | NZ_AP014635.1 | Vibrio tritonius |
| 310 | 739200 | 739310 | - | NC_013124.1 | Acidimicrobium ferrooxidans DSM 10331 |
| 311 | 609696 | 609806 | + | NC_010003.1 | Petrotoga mobilis SJ95 |
| 312 | 2883940 | 2884053 | - | NZ_CP061205.1 | Kordiimonas pumila |
| 313 | 2505731 | 2505859 | + | NZ_CP045851.1 | Actinomarinicola tropica |
| 314 | 645650 | 645760 | - | NZ_CP013237.1 | Streptococcus mutans |
| 315 | 1914119 | 1914229 | - | NZ_CP035130.1 | Gudongella oleilytica |
| 316 | 995669 | 995779 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 317 | 379253 | 379363 | - | NZ_CP027234.1 | Bacteroides heparinolyticus |
| 318 | 1178704 | 1178814 | - | NC_015559.1 | Marinomonas posidonica IVIA-Po-181 |
| 319 | 1903193 | 1903315 | - | NZ_CP013909.1 | Hymenobacter sedentarius |
| 320 | 324240 | 324350 | + | NZ_LR134167.1 | Avibacterium volantium |
| 321 | 1137940 | 1138071 | - | NZ_CP007774.1 | Campylobacter volucris LMG 24379 |
| 322 | 3350321 | 3350431 | - | NZ_CP027231.1 | Bacteroides zoogleoformans |
| 323 | 1456495 | 1456605 | + | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 324 | 1129692 | 1129826 | - | NZ_AP018721.1 | Sulfuritortus calidifontis |
| 325 | 1257138 | 1257248 | - | NZ_CP053848.1 | Campylobacter ornithocola |
| 326 | 865279 | 865389 | + | NZ_CP010450.1 | Streptococcus pyogenes |
| 327 | 1892286 | 1892414 | + | NC_021169.1 | Archaeoglobus sulfaticallidus PM70-1 |
| 328 | 1663734 | 1663859 | + | NZ_CP014263.1 | Spirosoma montaniterrae |
| 329 | 748827 | 748937 | + | NZ_LT629973.1 | Akkermansia glycaniphila |
| 330 | 1029484 | 1029600 | - | NZ_CP019981.1 | Pediococcus inopinatus |
| 331 | 2632361 | 2632471 | + | NZ_CP019082.1 | Paludisphaera borealis |
| 332 | 100732 | 100842 | - | NZ_CP014855.1 | Thermococcus gorgonarius |
| 333 | 1228849 | 1228959 | + | NZ_CP014855.1 | Thermococcus gorgonarius |
| 334 | 1651883 | 1651993 | - | NC_009051.1 | Methanoculleus marisnigri JR1 |
| 335 | 1570266 | 1570373 | + | NZ_CP035807.1 | Thiospirochaeta perfilievii |
| 336 | 170567 | 170677 | + | NZ_CP015029.1 | Frederiksenia canicola |
| 337 | 2440357 | 2440467 | - | NC_017527.1 | Methanosaeta harundinacea 6Ac |
| 338 | 3095598 | 3095711 | + | NC_011831.1 | Chloroflexus aggregans DSM 9485 |
| 339 | 1230815 | 1230937 | - | NC_011831.1 | Chloroflexus aggregans DSM 9485 |
| 340 | 3621926 | 3622033 | - | NZ_CP047897.1 | Nibribacter ruber |
| 341 | 573717 | 573827 | + | NZ_CP014176.1 | Clostridium argentinense |
| 342 | 967407 | 967517 | - | NC_016001.1 | Flavobacterium branchiophilum FL-15 |
| 343 | 1508005 | 1508127 | + | NZ_CP038631.1 | Halobacterium salinarum |
| 344 | 866130 | 866240 | - | NC_014633.1 | Ilyobacter polytropus DSM 2926 |
| 345 | 2892511 | 2892621 | - | NC_016940.1 | Saprospira grandis str. Lewin |
| 346 | 1512915 | 1513022 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 347 | 4975695 | 4975805 | - | NZ_CP020953.1 | Clostridium drakei |
| 348 | 207507 | 207617 | - | NC_011026.1 | Chloroherpeton thalassium ATCC 35110 |
| 349 | 94790 | 94909 | + | NC_008095.1 | Myxococcus xanthus DK 1622 |
| 350 | 1021846 | 1021956 | - | NC_014008.1 | Coraliomargarita akajimensis DSM 45221 |
| 351 | 4726031 | 4726159 | + | NZ_AP021876.1 | Desulfosarcina ovata subsp. sediminis |
| 352 | 2144836 | 2144964 | - | NZ_CP006577.1 | Archaeoglobus fulgidus DSM 8774 |
| 353 | 958398 | 958508 | + | NZ_CP016379.1 | Anoxybacter fermentans |
| 354 | 84840 | 84950 | - | NZ_CP030032.1 | Bradymonas sediminis |
| 355 | 4006432 | 4006542 | + | NZ_CP019285.1 | Halobiforma lacisalsi AJ5 |
| 356 | 1686743 | 1686874 | + | NZ_CP034145.1 | Haloplanus aerogenes |
| 357 | 3098175 | 3098297 | + | NZ_CP010311.1 | Geoalkalibacter subterraneus |
| 358 | 406658 | 406768 | - | NZ_CP036278.1 | Aeoliella mucimassa |
| 359 | 1664304 | 1664414 | + | NZ_CP021255.1 | Desulfobulbus oralis |
| 360 | 1413179 | 1413289 | - | NZ_AP018712.1 | Tepiditoga spiralis |
| 361 | 498452 | 498562 | + | NZ_CP012541.1 | Campylobacter concisus |
| 362 | 1251964 | 1252074 | - | NZ_LT608328.1 | Petrimonas mucosa |
| 363 | 1275979 | 1276095 | - | NZ_AP018437.1 | Pelolinea submarina |
| 364 | 4342174 | 4342284 | - | NC_012108.1 | Desulfobacterium autotrophicum HRM2 |
| 365 | 4327639 | 4327749 | - | NC_012108.1 | Desulfobacterium autotrophicum HRM2 |
| 366 | 1099239 | 1099367 | - | NZ_CP007034.1 | Barnesiella viscericola DSM 18177 |
| 367 | 3295701 | 3295832 | - | NZ_CP045696.1 | Sodaliphilus pleomorphus |
| 368 | 1390908 | 1391018 | - | NZ_AP013035.1 | Thermosulfidibacter takaii ABI70S6 |
| 369 | 5991228 | 5991368 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 370 | 145527 | 145637 | + | NZ_AP019309.1 | Intestinibaculum porci |
| 371 | 2212821 | 2212952 | + | NZ_CP031150.1 | Haloplanus rubicundus |
| 372 | 3638903 | 3639013 | + | NZ_CP019343.1 | Oceanicoccus sagamiensis |
| 373 | 834595 | 834717 | - | NZ_AP018042.1 | Labilibaculum antarcticum |
| 374 | 1234051 | 1234161 | - | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 375 | 1082718 | 1082825 | + | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 376 | 331205 | 331336 | + | NC_014314.1 | Dehalogenimonas lykanthroporepellens BL-DC-9 |
| 377 | 844130 | 844237 | + | NZ_LT906441.1 | Cutibacterium granulosum |
| 378 | 1565287 | 1565415 | - | NZ_CP030105.1 | Lactiplantibacillus plantarum |
| 379 | 1349302 | 1349412 | + | NC_008639.1 | Chlorobium phaeobacteroides DSM 266 |
| 380 | 498888 | 498998 | + | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 381 | 3614183 | 3614293 | + | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 382 | 1639380 | 1639490 | - | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 383 | 2026109 | 2026219 | + | NC_015666.1 | Halopiger xanaduensis SH-6 |
| 384 | 263934 | 264041 | - | NZ_CP011071.1 | Muricauda lutaonensis |
| 385 | 346658 | 346768 | + | NC_014632.1 | Ilyobacter polytropus DSM 2926 |
| 386 | 6246852 | 6246962 | - | NZ_AP021875.1 | Desulfosarcina widdelii |
| 387 | 102768 | 102914 | + | NZ_CP022203.1 | Corallococcus macrosporus DSM 14697 |
| 388 | 2726371 | 2726499 | + | NZ_CP013106.1 | Halomonas huangheensis |
| 389 | 1135777 | 1135887 | + | NZ_CP028107.1 | Fusobacterium necrophorum subsp. funduliforme |
| 390 | 2268477 | 2268587 | + | NC_015416.1 | Methanothrix soehngenii GP6 |
| 391 | 735697 | 735804 | + | NC_018178.1 | Melioribacter roseus P3M-2 |
| 392 | 1839744 | 1839854 | + | NZ_CP035810.1 | Brevibacterium luteolum |
| 393 | 2896827 | 2896949 | + | NZ_CP029145.1 | Hymenobacter nivis |
| 394 | 3159528 | 3159638 | - | NC_013222.1 | Robiginitalea biformata HTCC2501 |
| 395 | 458247 | 458354 | - | NZ_CP053841.1 | Campylobacter blaseri |
| 396 | 2007625 | 2007735 | - | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 397 | 1798412 | 1798522 | - | NC_013743.1 | Haloterrigena turkmenica DSM 5511 |
| 398 | 4163001 | 4163111 | + | NZ_CP069188.1 | Haloterrigena salifodinae |
| 399 | 2019820 | 2019930 | + | NC_018227.2 | Methanoculleus bourgensis MS2 |
| 400 | 277164 | 277271 | + | NZ_CP040106.1 | Echinicola rosea |
| 401 | 4694124 | 4694252 | + | NC_013235.1 | Nakamurella multipartita DSM 44233 |
| 402 | 1214605 | 1214715 | - | NZ_CP053825.1 | Campylobacter armoricus |
| 403 | 83597 | 83725 | - | NC_009943.1 | Desulfococcus oleovorans Hxd3 |
| 404 | 1937627 | 1937755 | - | NZ_CP018135.1 | Neomicrococcus aestuarii |
| 405 | 967775 | 967900 | - | NZ_CP018135.1 | Neomicrococcus aestuarii |
| 406 | 2194221 | 2194331 | - | NC_012982.1 | Hirschia baltica ATCC 49814 |
| 407 | 71829 | 71939 | - | NZ_CP019893.1 | Natrarchaeobaculum aegyptiacum |
| 408 | 2322874 | 2322984 | + | NZ_CP053351.1 | Winogradskyella schleiferi |
| 409 | 2821419 | 2821541 | - | NZ_CP040896.1 | Hymenobacter jejuensis |
| 410 | 5756723 | 5756833 | - | NZ_CP050063.1 | Spirosoma aureum |
| 411 | 3315209 | 3315331 | + | NC_018011.1 | Alistipes finegoldii DSM 17242 |
| 412 | 2713464 | 2713574 | + | NZ_CP060092.1 | Teredinibacter purpureus |
| 413 | 3543033 | 3543143 | - | NZ_LR699004.1 | Phocaeicola dorei |
| 414 | 647004 | 647114 | - | NZ_CP037922.1 | Hymenobacter radiodurans |
| 415 | 3191242 | 3191352 | - | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 416 | 1749161 | 1749271 | - | NZ_CP043405.1 | Streptococcus ratti |
| 417 | 837906 | 838016 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 418 | 927817 | 927927 | - | NZ_CP019327.1 | Haloterrigena daqingensis |
| 419 | 1304875 | 1304985 | + | NZ_CP063849.1 | Paludibaculum fermentans |
| 420 | 1105043 | 1105153 | - | NZ_AP019551.1 | Athalassotoga saccharophila |
| 421 | 1481705 | 1481815 | - | NZ_AP018725.1 | Sulfuriflexus mobilis |
| 422 | 639774 | 639884 | + | NZ_LN824141.1 | Defluviitoga tunisiensis |
| 423 | 565420 | 565530 | - | NZ_CP060782.1 | Sphingomonas sediminicola |
| 424 | 2753547 | 2753660 | - | NZ_CP019607.1 | Tessaracoccus flavescens |
| 425 | 4110105 | 4110215 | - | NZ_AP021874.1 | Desulfosarcina alkanivorans |
| 426 | 5029852 | 5029974 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 427 | 1022074 | 1022187 | - | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 428 | 1698453 | 1698575 | + | NC_007912.1 | Saccharophagus degradans 2-40 |
| 429 | 429813 | 429923 | + | NC_016148.1 | Thermovirga lienii DSM 17291 |
| 430 | 827134 | 827259 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 431 | 5947773 | 5947883 | + | NZ_CP060723.1 | Pedobacter roseus |
| 432 | 1109703 | 1109813 | - | NC_014330.1 | Brachyspira pilosicoli 95/1000 |
| 433 | 3675714 | 3675821 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
| 434 | 2347788 | 2347904 | - | NZ_CP053086.1 | Pelagibacterium halotolerans |
| 435 | 1551277 | 1551387 | + | NZ_AP018933.1 | Zymobacter palmae |
| 436 | 179963 | 180073 | + | NZ_CP036246.2 | [Arcobacter] porcinus |
| 437 | 2990577 | 2990708 | - | NZ_CP022272.1 | Shewanella marisflavi |
| 438 | 2416582 | 2416692 | - | NZ_CP007142.1 | Gynuella sunshinyii YC6258 |
| 439 | 615877 | 615987 | - | NZ_CP046415.1 | Guyparkeria halophila |
| 440 | 405477 | 405587 | - | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 441 | 1827523 | 1827645 | + | NZ_LT605205.1 | Proteiniphilum saccharofermentans |
| 442 | 1508850 | 1508981 | - | NZ_CP014143.1 | Microbulbifer aggregans |
| 443 | 1253249 | 1253359 | + | NZ_LT906459.1 | Odoribacter splanchnicus |
| 444 | 1103945 | 1104055 | - | NZ_CP033719.1 | Propionibacterium acidifaciens |
| 445 | 508194 | 508304 | - | NZ_CP054012.1 | Parabacteroides distasonis |
| 446 | 3428712 | 3428822 | + | NC_018721.1 | Psychroflexus torquis ATCC 700755 |
| 447 | 3277606 | 3277719 | + | NZ_CP016268.1 | Woeseia oceani |
| 448 | 2679865 | 2679972 | + | NZ_CP053348.1 | Winogradskyella forsetii |
| 449 | 284346 | 284456 | - | NZ_CP023864.1 | Prevotella jejuni |
| 450 | 2811752 | 2811859 | - | NZ_CP019633.1 | Sedimentisphaera cyanobacteriorum |
| 451 | 615210 | 615320 | + | NC_014371.1 | Prevotella melaninogenica ATCC 25845 |
| 452 | 2401139 | 2401267 | + | NC_017448.1 | Fibrobacter succinogenes subsp. succinogenes S85 |
| 453 | 2008603 | 2008713 | - | NZ_AP019827.1 | Leptotrichia shahii |
| 454 | 300277 | 300387 | - | NZ_CP012075.1 | Prevotella fusca JCM 17724 |
| 455 | 968083 | 968193 | + | NZ_CP054482.1 | Macrococcus bohemicus |
| 456 | 1982966 | 1983076 | + | NC_014033.1 | Prevotella ruminicola 23 |
| 457 | 412983 | 413093 | + | NZ_CP044285.1 | Hymenobacter baengnokdamensis |
| 458 | 3148213 | 3148323 | + | NC_016584.1 | Desulfosporosinus orientis DSM 765 |
| 459 | 4816982 | 4817107 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 460 | 3607996 | 3608106 | + | NZ_CP054836.1 | Oricola thermophila |
| 461 | 1505307 | 1505414 | + | NZ_CP014163.1 | Aerococcus urinaehominis |
| 462 | 2293858 | 2293965 | - | NZ_CP042437.1 | Mucilaginibacter ginsenosidivorax |
| 463 | 2731951 | 2732061 | + | NC_015167.1 | Cellulophaga lytica DSM 7489 |
| 464 | 4193286 | 4193405 | + | NZ_CP037953.1 | Permianibacter aggregans |
| 465 | 3651684 | 3651794 | + | NZ_CP036276.1 | Symmachiella dynata |
| 466 | 1761141 | 1761251 | - | NC_020304.1 | Desulfocapsa sulfexigens DSM 10523 |
| 467 | 530933 | 531052 | + | NZ_CP012543.1 | Campylobacter rectus |
| 468 | 2168920 | 2169030 | - | NZ_CP032757.1 | Lactiplantibacillus pentosus |
| 469 | 593755 | 593874 | + | NZ_CP012544.1 | Campylobacter showae |
| 470 | 4074037 | 4074147 | + | NZ_CP007145.1 | Hymenobacter swuensis DY53 |
| 471 | 5814724 | 5814831 | + | NZ_CP042914.1 | Roseimaritima ulvae |
| 472 | 6657528 | 6657638 | + | NZ_CP017641.1 | Fuerstia marisgermanicae |
| 473 | 2295451 | 2295561 | - | NZ_CP024047.1 | Natrarchaeobaculum sulfurireducens |
| 474 | 764722 | 764832 | + | NZ_LS483447.1 | Porphyromonas crevioricanis |
| 475 | 1579556 | 1579666 | + | NZ_CP024727.1 | Prevotella intermedia |
| 476 | 4387204 | 4387311 | + | NZ_CP013532.1 | Rhizobium phaseoli |
| 477 | 4894100 | 4894207 | + | NZ_AP017313.1 | Mucilaginibacter gotjawali |
| 478 | 1765232 | 1765342 | - | NZ_CP040863.1 | Rodentibacter heylii |
| 479 | 649826 | 649942 | + | NC_014734.1 | Paludibacter propionicigenes WB4 |
| 480 | 4376081 | 4376188 | + | NZ_CP071604.1 | Rhizobium binae |
| 481 | 1134495 | 1134605 | + | NC_022097.1 | Treponema pedis str. T A4 |
| 482 | 875131 | 875241 | - | NC_009881.1 | Rickettsia akari str. Hartford |
| 483 | 3046719 | 3046847 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 484 | 529538 | 529669 | - | NZ_CP014864.1 | Microbulbifer thermotolerans |
| 485 | 1029558 | 1029668 | + | NZ_CP031188.1 | Flavobacterium arcticum |
| 486 | 1701496 | 1701606 | + | NZ_CP014476.1 | Methylomonas denitrificans |
| 487 | 1708669 | 1708779 | - | NC_014166.1 | Arcobacter nitrofigilis DSM 7299 |
| 488 | 3774193 | 3774303 | + | NZ_CP047491.1 | Microbulbifer hydrolyticus |
| 489 | 1371189 | 1371320 | + | NC_013216.1 | Desulfofarcimen acetoxidans DSM 771 |
| 490 | 5789577 | 5789699 | - | NZ_CP043998.1 | Clostridium diolis |
| 491 | 375668 | 375778 | + | NC_016929.1 | Rickettsia canadensis str. CA410 |
| 492 | 599770 | 599880 | - | NC_019792.1 | Natronobacterium gregoryi SP2 |
| 493 | 2556501 | 2556611 | + | NC_007955.1 | Methanococcoides burtonii DSM 6242 |
| 494 | 1158844 | 1158960 | - | NZ_CP051131.1 | Parasphingopyxis algicola |
| 495 | 1786577 | 1786687 | - | NZ_CP065637.1 | Lactococcus garvieae |
| 496 | 2121170 | 2121280 | - | NZ_CP041345.1 | Tenuifilum thalassicum |
| 497 | 123917 | 124027 | + | NC_008942.1 | Methanocorpusculum labreanum Z |
| 498 | 4330225 | 4330332 | + | NZ_CP013500.1 | Rhizobium esperanzae |
| 499 | 510552 | 510659 | + | NZ_CP054139.1 | Mucilaginibacter mali |
| 500 | 4227055 | 4227162 | + | NZ_CP071612.1 | Rhizobium bangladeshense |
| 501 | 948129 | 948266 | - | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 502 | 891619 | 891732 | + | NZ_CP011853.1 | Gordonia phthalatica |
| 503 | 1174473 | 1174583 | + | NC_017187.1 | Aliarcobacter butzleri ED-1 |
| 504 | 161417 | 161527 | - | NC_017187.1 | Aliarcobacter butzleri ED-1 |
| 505 | 499366 | 499476 | + | NZ_CP021330.1 | Maritalea myrionectae |
| 506 | 5515757 | 5515867 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
| 507 | 422941 | 423054 | - | NZ_CP042430.1 | Baekduia soli |
| 508 | 82899 | 83012 | - | NZ_CP036523.1 | Peptacetobacter hiranonis |
| 509 | 2618275 | 2618382 | - | NZ_CP017560.1 | Sporosarcina ureilytica |
| 510 | 1672260 | 1672367 | + | NZ_CP071454.1 | Rhizobium lentis |
| 511 | 5442664 | 5442774 | + | NC_002516.2 | Pseudomonas aeruginosa PAO1 |
| 512 | 908138 | 908248 | - | NZ_AP019864.1 | Rickettsia heilongjiangensis |
| 513 | 722301 | 722411 | + | NZ_LN794217.1 | Rickettsia monacensis |
| 514 | 279660 | 279776 | - | NZ_CP013502.1 | Rhizobium esperanzae |
| 515 | 275802 | 275918 | - | NZ_CP013535.1 | Rhizobium phaseoli |
| 516 | 2763442 | 2763549 | - | NZ_CP046996.1 | Dehalobacter restrictus |
| 517 | 4019668 | 4019778 | - | NZ_CP019870.1 | Clostridioides difficile |
| 518 | 334093 | 334203 | + | NZ_CP020772.1 | Halobacillus mangrovi |
| 519 | 6304588 | 6304698 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 520 | 897069 | 897179 | - | NC_003103.1 | Rickettsia conorii str. Malish 7 |
| 521 | 904566 | 904676 | - | NC_016639.1 | Rickettsia slovaca 13-B |
| 522 | 909541 | 909648 | + | NZ_CP020867.1 | Campylobacter cuniculorum DSM 23162 = LMG 24588 |
| 523 | 900047 | 900157 | - | NC_010263.3 | Rickettsia rickettsii str. Iowa |
| 524 | 3010056 | 3010166 | - | NZ_LR027382.1 | Alistipes megaguti |
| 525 | 1642222 | 1642329 | - | NC_017464.1 | Ignavibacterium album JCM 16511 |
| 526 | 312996 | 313115 | + | NZ_CP068013.1 | Paenarthrobacter ureafaciens |
| 527 | 213596 | 213706 | - | NZ_CP032100.1 | Arcobacter suis CECT 7833 |
| 528 | 1361026 | 1361136 | + | NZ_CP032100.1 | Arcobacter suis CECT 7833 |
| 529 | 543816 | 543926 | - | NZ_LT906477.1 | Clostridium cochlearium |
| 530 | 3367790 | 3367897 | - | NZ_CP014616.1 | Sporosarcina psychrophila |
| 531 | 1316102 | 1316212 | + | NZ_CP030944.1 | Arcobacter aquimarinus |
| 532 | 212002 | 212112 | - | NZ_CP030944.1 | Arcobacter aquimarinus |
| 533 | 1318108 | 1318218 | - | NZ_CP053833.1 | Arcobacter cloacae |
| 534 | 264402 | 264512 | - | NZ_CP053833.1 | Arcobacter cloacae |
| 535 | 1769626 | 1769739 | - | NZ_CP035288.1 | Staphylococcus epidermidis |
| 536 | 296249 | 296371 | + | NZ_CP032869.1 | Mucilaginibacter celer |
| 537 | 868871 | 868984 | + | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 538 | 3678975 | 3679097 | + | NZ_CP016895.1 | Acinetobacter larvae |
| 539 | 1469121 | 1469231 | - | NZ_CP019070.1 | Poseidonibacter parvus |
| 540 | 2767584 | 2767700 | - | NZ_CP015318.1 | Mesorhizobium amorphae CCNWGS0123 |
| 541 | 1511922 | 1512032 | - | NZ_CP042652.1 | Pseudoarcobacter acticola |
| 542 | 353244 | 353354 | + | NZ_CP042652.1 | Pseudoarcobacter acticola |
| 543 | 3198600 | 3198728 | + | NC_020520.1 | Ilumatobacter coccineus YM16-304 |
| 544 | 1903959 | 1904066 | + | NZ_CP032382.1 | Chryseolinea soli |
| 545 | 565729 | 565842 | + | NZ_LN681225.1 | Legionella hackeliae |
| 546 | 2763764 | 2763874 | + | NZ_CP031466.1 | Paraburkholderia caffeinilytica |
++ More..