Result : EXP02823
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02823 |
| NCBI Accession ID | |
| Organism | Veillonella |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGGCTAAACGTATTCGTACTATCAACACTGAATCCTTGCAAAAAACTGCTAAAACTGGCGGTTGTGGGGAATGTCAAACATCTTGCCAATCTGCTTGCAAAACAAGCTGCACAGTTGGTAACCAAGTTTGCTAA |
| Sequence | MAKRIRTINTESLQKTAKTGGCGECQTSCQSACKTSCTVGNQVC |
| Source of smORF | Metagenomic Ribo-seq |
| Function | The ORF matches to the profile of cl26253. Profile Description: Six-cysteine peptide SCIFF. Members of this protein family are essentially universal in the class Clostidia and therefore highly abundant in the human gut microbiome. This short peptide is designated SCIFF, for Six Cysteines in Forty-Five residues. It is a presumed ribosomal natural product precursor, always found associated with a yet-uncharacterized radical SAM protein, family TIGR03974, that resembles other peptide modification radical SAM enzymes and is designated SCIFF radical SAM maturase. |
| Pubmed ID | 32601270 |
| Domain | CDD:421283 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 44 |
++ More..
| Conservation Analysis |
No. of Species: 156
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1420630 | 1420773 | - | NZ_LR778174.1 | Veillonella parvula |
| 2 | 1362315 | 1362458 | - | NZ_LR134375.1 | Veillonella dispar |
| 3 | 1310022 | 1310165 | - | NZ_AP022321.1 | Veillonella nakazawae |
| 4 | 741476 | 741619 | + | NZ_LT906470.1 | Veillonella rodentium |
| 5 | 1369153 | 1369293 | + | NZ_CP009240.1 | Megasphaera elsdenii 14-14 |
| 6 | 635056 | 635199 | + | NC_013740.1 | Acidaminococcus fermentans DSM 20731 |
| 7 | 2289762 | 2289902 | + | NZ_CP029462.1 | Megasphaera stantonii |
| 8 | 617299 | 617448 | + | NC_015437.1 | Selenomonas sputigena ATCC 35185 |
| 9 | 3601328 | 3601468 | - | NZ_CP039126.1 | Blautia producta |
| 10 | 2659331 | 2659474 | + | NZ_AP018449.1 | Methylomusa anaerophila |
| 11 | 2448922 | 2449062 | + | NZ_CP048000.1 | Anaerocolumna sedimenticola |
| 12 | 877287 | 877430 | + | NZ_CP045875.1 | Heliorestis convoluta |
| 13 | 2553825 | 2553968 | - | NZ_CP045798.1 | Thermoanaerosceptrum fracticalcis |
| 14 | 1175232 | 1175375 | - | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 15 | 1234930 | 1235070 | + | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 16 | 86896 | 87021 | - | NZ_CP019698.1 | Desulfotomaculum ferrireducens |
| 17 | 4289525 | 4289665 | - | NC_018017.1 | Desulfitobacterium dehalogenans ATCC 51507 |
| 18 | 3591373 | 3591513 | - | NC_019903.1 | Desulfitobacterium dichloroeliminans LMG P-21439 |
| 19 | 3144509 | 3144649 | - | NZ_CP007032.1 | Desulfitobacterium metallireducens DSM 15288 |
| 20 | 2194046 | 2194186 | - | NZ_CP030280.1 | Blautia argi |
| 21 | 1048853 | 1048993 | + | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 22 | 5244166 | 5244306 | - | NC_011830.1 | Desulfitobacterium hafniense DCB-2 |
| 23 | 3459251 | 3459391 | - | NZ_CP036259.1 | Sporomusa termitida |
| 24 | 2804672 | 2804809 | - | NC_015275.1 | Cellulosilyticum lentocellum DSM 5427 |
| 25 | 3580182 | 3580325 | - | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 26 | 828313 | 828453 | - | NZ_LT906446.1 | Megamonas hypermegale |
| 27 | 4815594 | 4815734 | - | NC_018515.1 | Desulfosporosinus meridiei DSM 13257 |
| 28 | 1117321 | 1117461 | + | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 29 | 5801343 | 5801483 | - | NC_016584.1 | Desulfosporosinus orientis DSM 765 |
| 30 | 3022684 | 3022824 | - | NZ_CP046996.1 | Dehalobacter restrictus |
| 31 | 2128873 | 2129016 | - | NZ_AP019004.1 | Phascolarctobacterium faecium |
| 32 | 3942067 | 3942213 | - | NC_015589.1 | Desulfotomaculum ruminis DSM 2154 |
| 33 | 4877416 | 4877556 | - | NC_018068.1 | Desulfosporosinus acidiphilus SJ4 |
| 34 | 1013560 | 1013703 | - | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 35 | 974160 | 974300 | + | NZ_LR027880.1 | Roseburia intestinalis L1-82 |
| 36 | 3156187 | 3156312 | + | NZ_CP070062.1 | Coprococcus comes |
| 37 | 2555920 | 2556060 | - | NZ_LR699011.1 | Roseburia hominis |
| 38 | 2617509 | 2617652 | + | NZ_LT990039.1 | Massilistercora timonensis |
| 39 | 5646616 | 5646744 | - | NZ_CP022464.2 | Enterocloster bolteae |
| 40 | 670325 | 670462 | + | NC_014376.1 | [Clostridium] saccharolyticum WM1 |
| 41 | 4783147 | 4783299 | - | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 42 | 845265 | 845405 | + | NZ_CP022121.1 | Dehalobacterium formicoaceticum |
| 43 | 3366095 | 3366235 | - | NC_015172.1 | Syntrophobotulus glycolicus DSM 8271 |
| 44 | 954144 | 954293 | + | NC_014614.1 | Acetoanaerobium sticklandii |
| 45 | 3077387 | 3077536 | + | NZ_LR130778.1 | Petrocella atlantisensis |
| 46 | 2592891 | 2593034 | - | NZ_CP036345.1 | Anaerostipes caccae L1-92 |
| 47 | 948427 | 948570 | + | NZ_CP040058.1 | Anaerostipes rhamnosivorans |
| 48 | 1444833 | 1444985 | + | NZ_LT635772.1 | Anaerococcus mediterraneensis |
| 49 | 1436976 | 1437122 | - | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
| 50 | 2265159 | 2265290 | + | NZ_CP048436.1 | Flavonifractor plautii |
| 51 | 1190226 | 1190366 | - | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 52 | 580496 | 580639 | + | NC_014657.1 | Caldicellulosiruptor owensensis OL |
| 53 | 1172356 | 1172502 | + | NZ_CP030777.1 | Faecalibacterium prausnitzii |
| 54 | 1550695 | 1550817 | - | NZ_CP025286.1 | Ethanoligenens harbinense YUAN-3 |
| 55 | 760364 | 760510 | + | NZ_LR134524.1 | Peptoniphilus harei |
| 56 | 978197 | 978340 | + | NZ_CP007452.1 | Peptoclostridium acidaminophilum DSM 3953 |
| 57 | 1208026 | 1208175 | + | NZ_CP066014.1 | Anaerococcus vaginalis |
| 58 | 1822854 | 1823003 | + | NZ_CP067016.1 | Anaerococcus obesiensis |
| 59 | 2442828 | 2442968 | - | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 60 | 2635490 | 2635630 | - | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 61 | 73396 | 73548 | + | NC_013216.1 | Desulfofarcimen acetoxidans DSM 771 |
| 62 | 1356000 | 1356143 | + | NC_009437.1 | Caldicellulosiruptor saccharolyticus DSM 8903 |
| 63 | 2263118 | 2263261 | - | NC_014833.1 | Ruminococcus albus 7 = DSM 20455 |
| 64 | 1212127 | 1212270 | + | NZ_HF545616.1 | Ruminococcus bicirculans |
| 65 | 3350427 | 3350570 | - | NZ_CP036170.1 | [Clostridium] scindens ATCC 35704 |
| 66 | 706963 | 707106 | + | NC_012034.1 | Caldicellulosiruptor bescii DSM 6725 |
| 67 | 628937 | 629080 | + | NC_014721.1 | Caldicellulosiruptor kristjanssonii I77R1B |
| 68 | 2081305 | 2081448 | - | NC_014652.1 | Caldicellulosiruptor hydrothermalis 108 |
| 69 | 1860093 | 1860236 | - | NC_015949.1 | Caldicellulosiruptor lactoaceticus 6A |
| 70 | 685122 | 685265 | + | NC_014392.1 | Caldicellulosiruptor obsidiansis OB47 |
| 71 | 2358529 | 2358669 | - | NC_014220.1 | Syntrophothermus lipocalidus DSM 12680 |
| 72 | 356721 | 356864 | + | NZ_CP029256.1 | Christensenella minuta |
| 73 | 2436753 | 2436899 | - | NC_014387.1 | Butyrivibrio proteoclasticus B316 |
| 74 | 619980 | 620120 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 75 | 1927664 | 1927810 | - | NZ_CP032364.1 | Lachnoanaerobaculum umeaense |
| 76 | 1794161 | 1794304 | + | NZ_CP009687.1 | Clostridium aceticum |
| 77 | 638386 | 638529 | + | NZ_CP034791.1 | Caldicellulosiruptor changbaiensis |
| 78 | 1940749 | 1940892 | + | NZ_CP020559.1 | Clostridium formicaceticum |
| 79 | 2184826 | 2184969 | - | NC_014720.1 | Caldicellulosiruptor kronotskyensis 2002 |
| 80 | 3056890 | 3057036 | - | NZ_CP014223.1 | Anaerotignum propionicum DSM 1682 |
| 81 | 1395279 | 1395422 | - | NZ_AP019309.1 | Intestinibaculum porci |
| 82 | 4570156 | 4570308 | + | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 83 | 2083054 | 2083194 | - | NZ_CP025197.1 | Acetivibrio saccincola |
| 84 | 1182573 | 1182713 | + | NC_003869.1 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 |
| 85 | 784566 | 784715 | + | NZ_CP009428.1 | Paenibacillus odorifer |
| 86 | 1942960 | 1943106 | + | NC_016048.1 | Oscillibacter valericigenes Sjm18-20 |
| 87 | 3266827 | 3266973 | - | NZ_CP048649.1 | Aminipila butyrica |
| 88 | 4104008 | 4104157 | - | NZ_CP045293.1 | Paenibacillus guangzhouensis |
| 89 | 1561107 | 1561247 | + | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 90 | 3118378 | 3118521 | - | NZ_CP014150.1 | Paeniclostridium sordellii |
| 91 | 837911 | 838057 | - | NZ_LR134523.1 | Peptoniphilus ivorii |
| 92 | 601944 | 602084 | - | NC_016630.1 | Filifactor alocis ATCC 35896 |
| 93 | 982574 | 982702 | - | NZ_LT632322.1 | Murdochiella vaginalis |
| 94 | 5670873 | 5671013 | + | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 95 | 332133 | 332282 | + | NZ_LT635480.1 | Ndongobacter massiliensis |
| 96 | 687921 | 688064 | + | NZ_CP036523.1 | Peptacetobacter hiranonis |
| 97 | 1821073 | 1821213 | - | NC_009922.1 | Alkaliphilus oremlandii OhILAs |
| 98 | 889916 | 890059 | + | NZ_CP019870.1 | Clostridioides difficile |
| 99 | 1558427 | 1558564 | - | NZ_CP047602.1 | Thermoanaerobacterium aotearoense |
| 100 | 960106 | 960216 | + | NC_015520.1 | Mahella australiensis 50-1 BON |
| 101 | 2411970 | 2412110 | + | NC_009633.1 | Alkaliphilus metalliredigens QYMF |
| 102 | 1074330 | 1074467 | + | NC_014964.1 | Thermoanaerobacter brockii subsp. finnii Ako-1 |
| 103 | 206446 | 206595 | + | NZ_LT635475.1 | Ezakiella massiliensis |
| 104 | 1117459 | 1117599 | + | NZ_CP035130.1 | Gudongella oleilytica |
| 105 | 2830872 | 2830997 | - | NC_018870.1 | Thermacetogenium phaeum DSM 12270 |
| 106 | 862426 | 862542 | - | NZ_CP027228.1 | Mogibacterium diversum |
| 107 | 3922457 | 3922606 | + | NZ_CP019659.1 | Paenibacillus larvae subsp. larvae |
| 108 | 1711762 | 1711902 | + | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 109 | 2148048 | 2148170 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 110 | 1560096 | 1560233 | - | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 111 | 1482480 | 1482617 | - | NC_015555.1 | Thermoanaerobacterium xylanolyticum LX-11 |
| 112 | 1188462 | 1188599 | + | NC_015958.1 | Thermoanaerobacter wiegelii Rt8.B1 |
| 113 | 1094182 | 1094319 | + | NC_014209.1 | Thermoanaerobacter mathranii subsp. mathranii str. A3 |
| 114 | 2284239 | 2284358 | - | NC_020134.1 | Thermoclostridium stercorarium subsp. stercorarium DSM 8532 |
| 115 | 1065811 | 1065948 | + | NC_013921.1 | Thermoanaerobacter italicus Ab9 |
| 116 | 1098241 | 1098378 | + | NZ_CP009170.1 | Thermoanaerobacter kivui |
| 117 | 1819770 | 1819910 | - | NC_018664.1 | Gottschalkia acidurici 9a |
| 118 | 2478577 | 2478729 | - | NZ_CP017237.1 | Moorella thermoacetica |
| 119 | 2420923 | 2421048 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 120 | 927998 | 928135 | + | NZ_CP014170.1 | Clostridium tyrobutyricum |
| 121 | 717699 | 717842 | + | NZ_LT635479.1 | Lachnoclostridium phocaeense |
| 122 | 3133583 | 3133720 | - | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 123 | 1665250 | 1665387 | + | NZ_CP040924.1 | Clostridium thermarum |
| 124 | 23759 | 23869 | + | NC_013385.1 | Ammonifex degensii KC4 |
| 125 | 5277309 | 5277446 | + | NZ_CP009933.1 | Clostridium scatologenes |
| 126 | 3839923 | 3840060 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 127 | 4665707 | 4665844 | - | NZ_CP020953.1 | Clostridium drakei |
| 128 | 2592232 | 2592369 | - | NZ_CP015756.1 | Clostridium estertheticum subsp. estertheticum |
| 129 | 1855578 | 1855715 | - | NZ_LT906477.1 | Clostridium cochlearium |
| 130 | 1333339 | 1333491 | - | NC_014377.1 | Thermosediminibacter oceani DSM 16646 |
| 131 | 2482060 | 2482197 | - | NC_014393.1 | Clostridium cellulovorans 743B |
| 132 | 3691158 | 3691295 | - | NC_014328.1 | Clostridium ljungdahlii DSM 13528 |
| 133 | 1364346 | 1364483 | - | NZ_CP012395.1 | Clostridium autoethanogenum DSM 10061 |
| 134 | 2385736 | 2385876 | - | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 135 | 1740452 | 1740589 | + | NZ_CP014176.1 | Clostridium argentinense |
| 136 | 2211193 | 2211330 | - | NZ_HG917868.1 | Clostridium bornimense |
| 137 | 2393556 | 2393693 | - | NZ_CP013019.1 | Clostridium pasteurianum |
| 138 | 3221953 | 3222090 | - | NZ_CP028842.1 | Clostridium botulinum |
| 139 | 3452301 | 3452438 | - | NZ_CP011663.1 | Clostridium sporogenes |
| 140 | 1854498 | 1854635 | - | NC_010718.1 | Natranaerobius thermophilus JW/NM-WN-LF |
| 141 | 1931380 | 1931517 | - | NZ_LR590481.1 | Hathewaya histolytica |
| 142 | 1521579 | 1521725 | + | NC_016894.1 | Acetobacterium woodii DSM 1030 |
| 143 | 966519 | 966656 | + | NZ_CP032416.1 | Clostridium fermenticellae |
| 144 | 2140498 | 2140635 | - | NZ_CP014204.2 | Clostridium baratii |
| 145 | 702432 | 702569 | + | NZ_CP016786.1 | Clostridium isatidis |
| 146 | 1046182 | 1046319 | + | NC_008593.1 | Clostridium novyi NT |
| 147 | 585306 | 585443 | - | NZ_CP071376.1 | Clostridium gasigenes |
| 148 | 2587984 | 2588121 | - | NZ_CP017253.2 | Clostridium taeniosporum |
| 149 | 2440709 | 2440849 | - | NC_008261.1 | Clostridium perfringens ATCC 13124 |
| 150 | 1373262 | 1373399 | + | NZ_CP027286.1 | Clostridium chauvoei |
| 151 | 4290797 | 4290934 | - | NC_022571.1 | Clostridium saccharobutylicum DSM 13864 |
| 152 | 2807169 | 2807306 | - | NZ_CP030775.1 | Clostridium butyricum |
| 153 | 2806236 | 2806379 | - | NC_008346.1 | Syntrophomonas wolfei subsp. wolfei str. Goettingen G311 |
| 154 | 1805936 | 1806073 | + | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 155 | 95349 | 95486 | - | NZ_CP023671.1 | Clostridium septicum |
| 156 | 4717886 | 4718023 | - | NZ_CP043998.1 | Clostridium diolis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_013740.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13186.8 | 0.71 | 111 | 101 | same-strand | Iron-sulfur cluster-binding domain |
| 2 | PF13394.8 | 0.63 | 98 | 95.5 | same-strand | 4Fe-4S single cluster domain |
| 3 | PF13353.8 | 0.74 | 116 | 101.0 | same-strand | 4Fe-4S single cluster domain |
| 4 | PF04055.23 | 0.64 | 100 | 100.0 | same-strand | Radical SAM superfamily |
++ More..