Result : B7GYQ9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L25 |
| NCBI Accession ID | CP001172.1 |
| Organism | Acinetobacter baumannii (strain AB307-0294) |
| Left | 2955913 |
| Right | 2956209 |
| Strand | + |
| Nucleotide Sequence | ATGGCAAACTTCGTATTAAACGCTCAAGCGCGTGCTGAAGACAAACAAGGGAAAGGTGCGAGCCGCCGCCTTCGTCGCGAATCTTTAGTTCCAGCTATCATCTACGGTGGTAACGCTGAGCCTGTAGCAGTTACTTTAGAACTTCGTGAGCTTGTAAAAGCTTTAGAAAGCAACGTTTTCTTTGAAGAAGTTGTTGAAATCAAAGTAGGTGACAAAGTTGAAAACGTTAAAATCCAAGCGTTACAACGTCACCCAGCTAAAAACACTCCTATGCACGCTGACTTCAAACGCGCATAA |
| Sequence | MANFVLNAQARAEDKQGKGASRRLRRESLVPAIIYGGNAEPVAVTLELRELVKALESNVFFEEVVEIKVGDKVENVKIQALQRHPAKNTPMHADFKRA |
| Source of smORF | Swiss-Prot |
| Function | This is one of the proteins that binds to the 5S RNA in the ribosome where it forms part of the central protuberance. {ECO:0000255|HAMAP-Rule:MF_01336}. |
| Pubmed ID | 18931120 |
| Domain | CDD:412568 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B7GYQ9 |
| ORF Length (Amino Acid) | 98 |
++ More..
| Conservation Analysis |
No. of Species: 43
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3126235 | 3126531 | + | NZ_CP015121.1 | Acinetobacter baumannii |
| 2 | 1215796 | 1216092 | + | NZ_CP040105.1 | Acinetobacter nosocomialis M2 |
| 3 | 3236227 | 3236523 | + | NZ_CP065820.1 | Acinetobacter seifertii |
| 4 | 104187 | 104483 | - | NC_016603.1 | Acinetobacter pittii PHEA-2 |
| 5 | 3105548 | 3105844 | + | NZ_CP053391.1 | Acinetobacter lactucae |
| 6 | 3306187 | 3306483 | + | NC_014259.1 | Acinetobacter oleivorans DR1 |
| 7 | 1078175 | 1078471 | + | NZ_CP070518.1 | Acinetobacter calcoaceticus |
| 8 | 2845509 | 2845805 | + | NC_005966.1 | Acinetobacter baylyi ADP1 |
| 9 | 1208702 | 1208998 | - | NZ_CP071766.1 | Acinetobacter towneri |
| 10 | 2607417 | 2607713 | + | NZ_CP030880.1 | Acinetobacter haemolyticus |
| 11 | 850450 | 850746 | - | NZ_CP024632.1 | Acinetobacter junii |
| 12 | 2177617 | 2177913 | + | NZ_CP041970.1 | Acinetobacter dispersus |
| 13 | 1071666 | 1071962 | - | NZ_CP049801.1 | Acinetobacter shaoyimingii |
| 14 | 873570 | 873866 | - | NZ_CP029397.2 | Acinetobacter defluvii |
| 15 | 836937 | 837233 | - | NZ_CP044483.1 | Acinetobacter schindleri |
| 16 | 958164 | 958460 | - | NZ_CP032134.1 | Acinetobacter chinensis |
| 17 | 1595733 | 1596029 | - | NZ_CP012808.1 | Acinetobacter equi |
| 18 | 1112854 | 1113150 | - | NZ_AP014630.1 | Acinetobacter guillouiae |
| 19 | 2011693 | 2011989 | + | NZ_CP045650.1 | Acinetobacter wanghuae |
| 20 | 2486250 | 2486546 | + | NZ_CP049916.1 | Acinetobacter lanii |
| 21 | 21357 | 21653 | + | NZ_CP035936.1 | Acinetobacter cumulans |
| 22 | 1005296 | 1005592 | - | NZ_CP035934.2 | Acinetobacter cumulans |
| 23 | 1120725 | 1121027 | - | NZ_CP016895.1 | Acinetobacter larvae |
| 24 | 1859373 | 1859660 | - | NZ_CP015029.1 | Frederiksenia canicola |
| 25 | 965122 | 965409 | - | NZ_CP006954.1 | Bibersteinia trehalosi USDA-ARS-USMARC-188 |
| 26 | 1205499 | 1205786 | - | NZ_CP006944.1 | Mannheimia varigena USDA-ARS-USMARC-1312 |
| 27 | 1398838 | 1399125 | + | NZ_CP046531.1 | Mannheimia ovis |
| 28 | 1692314 | 1692601 | - | NZ_CP055305.1 | Mannheimia pernigra |
| 29 | 575407 | 575694 | + | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
| 30 | 1005092 | 1005379 | + | NZ_CP016604.1 | Otariodibacter oris |
| 31 | 1729452 | 1729739 | - | NZ_CP061280.1 | Mannheimia bovis |
| 32 | 969774 | 970061 | - | NZ_CP007715.1 | Actinobacillus equuli subsp. equuli |
| 33 | 924112 | 924399 | - | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
| 34 | 1904200 | 1904487 | - | NZ_CP029206.1 | Actinobacillus porcitonsillarum |
| 35 | 1963802 | 1964056 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 36 | 2685984 | 2686265 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 37 | 1782491 | 1782775 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 38 | 1670064 | 1670345 | + | NZ_CP016176.1 | Xenorhabdus hominickii |
| 39 | 1790609 | 1790890 | - | NZ_CP072455.1 | Xenorhabdus budapestensis |
| 40 | 1386743 | 1387030 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 41 | 2847285 | 2847566 | + | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 42 | 1831489 | 1831773 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 43 | 1264085 | 1264366 | - | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 44 | 852448 | 852729 | - | NZ_CP060401.1 | Xenorhabdus nematophila |
++ More..