Result : EXP02586
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02586 |
| NCBI Accession ID | |
| Organism | Bacteroides,Paraprevotella,Clostridium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGGAAATGAAAAGAACAAATGACACAATCGAGATGTTGCAGTATCAGTTGAAAAGATACAAAGCAATGAGAAAGGGAGCTGCATGCCAGTCTTTGCAATACAAGCTTCACAAGTTAATGAGCCAACAGGCCAATGCCTAA |
| Sequence | MEMKRTNDTIEMLQYQLKRYKAMRKGAACQSLQYKLHKLMSQQANA |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 46 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 350563 | 350697 | + | NZ_LR699004.1 | Phocaeicola dorei |
| 2 | 299315 | 299449 | + | NC_009614.1 | Phocaeicola vulgatus ATCC 8482 |
| 3 | 873060 | 873197 | - | NZ_CP015401.2 | Bacteroides caecimuris |
| 4 | 6060976 | 6061113 | - | NZ_CP012938.1 | Bacteroides ovatus |
| 5 | 3115222 | 3115359 | - | NZ_CP040530.1 | Bacteroides thetaiotaomicron |
| 6 | 3236540 | 3236677 | + | NZ_CP069440.1 | Phocaeicola coprophilus |
| 7 | 289258 | 289398 | - | NZ_CP027234.1 | Bacteroides heparinolyticus |
| 8 | 1966237 | 1966383 | - | NC_014933.1 | Bacteroides helcogenes P 36-108 |
| 9 | 2920619 | 2920732 | - | NZ_CP027231.1 | Bacteroides zoogleoformans |
| 10 | 1340454 | 1340588 | + | NZ_LN877293.1 | Bacteroides fragilis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP015401.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00817.22 | 0.6 | 6 | 3661.5 | opposite-strand | impB/mucB/samB family |
| 2 | PF11799.10 | 0.6 | 6 | 3661.5 | opposite-strand | impB/mucB/samB family C-terminal domain |
| 3 | PF11798.10 | 0.6 | 6 | 3661.5 | opposite-strand | IMS family HHH motif |
| 4 | PF01841.21 | 0.7 | 7 | 1944 | opposite-strand | Transglutaminase-like superfamily |
++ More..