Result : EXP02510
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02510 |
| NCBI Accession ID | |
| Organism | Eubacterium |
| Left | |
| Right | |
| Strand | |
| Nucleotide Sequence | ATGGAAGAATATGAGATCGAGGGGACCGAGCTTATGGCACGTGCAATCTGTCATGAGTTAGACCACCTTGACGGACATATGTACACGGAGATTGTAGAAGGACCGTTACATGATGTAACTTATGATGATCCGGAGGAATAA |
| Sequence | MEEYEIEGTELMARAICHELDHLDGHMYTEIVEGPLHDVTYDDPEE |
| Source of smORF | Metagenomic Ribo-seq |
| Function | |
| Pubmed ID | 32601270 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 46 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1542147 | 1542287 | + | NZ_LR027880.1 | Roseburia intestinalis L1-82 |
| 2 | 2181597 | 2181740 | - | NZ_LR699011.1 | Roseburia hominis |
| 3 | 2133884 | 2134024 | - | NZ_LT635479.1 | Lachnoclostridium phocaeense |
| 4 | 1744643 | 1744783 | + | NZ_CP039126.1 | Blautia producta |
| 5 | 2850957 | 2851091 | + | NZ_CP070062.1 | Coprococcus comes |
| 6 | 1023864 | 1024004 | + | NZ_CP030280.1 | Blautia argi |
| 7 | 2154246 | 2154386 | - | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 8 | 3533958 | 3534095 | + | NZ_CP048000.1 | Anaerocolumna sedimenticola |
| 9 | 3559013 | 3559159 | - | NZ_CP022464.2 | Enterocloster bolteae |
| 10 | 866946 | 867092 | + | NZ_LN879430.1 | Herbinix luporum |
| 11 | 3059161 | 3059307 | - | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 12 | 3455778 | 3455912 | - | NZ_AP023367.1 | Anaerocolumna cellulosilytica |
| 13 | 1980707 | 1980829 | - | NC_014614.1 | Acetoanaerobium sticklandii |
| 14 | 719101 | 719238 | + | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR027880.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08245.14 | 0.86 | 12 | 2648.0 | same-strand | Mur ligase middle domain |
| 2 | PF02875.23 | 0.86 | 12 | 2637 | same-strand | Mur ligase family, glutamate ligase domain |
| 3 | PF01225.27 | 0.86 | 12 | 2635.5 | same-strand | Mur ligase family, catalytic domain |
| 4 | PF17764.3 | 1.0 | 14 | 365.0 | same-strand | 3'DNA-binding domain (3'BD) |
| 5 | PF04851.17 | 1.0 | 14 | 365.0 | same-strand | Type III restriction enzyme, res subunit |
| 6 | PF00270.31 | 1.0 | 14 | 365.0 | same-strand | DEAD/DEAH box helicase |
| 7 | PF18074.3 | 0.86 | 12 | 369.5 | same-strand | Primosomal protein N C-terminal domain |
| 8 | PF18319.3 | 1.0 | 14 | 365.0 | same-strand | PriA DNA helicase Cys-rich region (CRR) domain |
| 9 | PF00551.21 | 1.0 | 14 | 12.0 | same-strand | Formyl transferase |
| 10 | PF02911.20 | 1.0 | 14 | 12.0 | same-strand | Formyl transferase, C-terminal domain |
| 11 | PF04298.14 | 0.79 | 11 | 1103 | same-strand | Putative neutral zinc metallopeptidase |
| 12 | PF01189.19 | 0.93 | 13 | 1737 | same-strand | 16S rRNA methyltransferase RsmB/F |
| 13 | PF01029.20 | 1.0 | 14 | 1753.0 | same-strand | NusB family |
| 14 | PF17125.7 | 0.79 | 11 | 1737 | same-strand | N-terminal domain of 16S rRNA methyltransferase RsmF |
| 15 | PF04055.23 | 0.93 | 13 | 3040 | same-strand | Radical SAM superfamily |
| 16 | PF13672.8 | 0.79 | 11 | 4103 | same-strand | Protein phosphatase 2C |
| 17 | PF07228.14 | 0.64 | 9 | 4097 | same-strand | Stage II sporulation protein E (SpoIIE) |
++ More..