Result : EXP02363
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02363 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 3513473 |
| Right | 3513631 |
| Strand | - |
| Nucleotide Sequence | GTGTCTGTCAGACCGGGACCTCCCGCGGCCCGGACCCTGGCATCAGCTAGCGGGATCAACCGGTGGCTTCGGCCGCGGAGGCCACCGGGACATCAAACAGCGGCTGGGATCGTCATCTCGGCTTGTTCGCGGGACCGAGAGATCCAAGTAGAGGCATAG |
| Sequence | VSVRPGPPAARTLASASGINRWLRPRRPPGHQTAAGIVISACSRDREIQVEA |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to be essential for the bacterium in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 52 |
++ More..
| Conservation Analysis |
No. of Species: 30
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3520787 | 3520945 | - | NZ_CP014955.1 | Mycobacteroides abscessus |
| 2 | 3248101 | 3248238 | - | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 3 | 3579957 | 3580115 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 4 | 1884258 | 1884416 | - | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 5 | 3065609 | 3065767 | + | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 6 | 8505 | 8663 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 7 | 5851197 | 5851355 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 8 | 3884330 | 3884488 | - | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 9 | 1914735 | 1914896 | + | NZ_AP022618.1 | Mycolicibacterium insubricum |
| 10 | 1468222 | 1468380 | - | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 11 | 3640929 | 3641087 | - | NZ_CP027793.1 | Rhodococcus hoagii |
| 12 | 1854515 | 1854652 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
| 13 | 5626073 | 5626210 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 14 | 2123650 | 2123787 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 15 | 2653479 | 2653637 | - | NZ_CP048813.1 | Rhodococcus triatomae |
| 16 | 5143347 | 5143484 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 17 | 5098290 | 5098427 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 18 | 2047518 | 2047676 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 19 | 1836525 | 1836683 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 20 | 94306 | 94464 | + | NZ_AP022620.1 | Mycolicibacterium anyangense |
| 21 | 2326090 | 2326230 | - | NZ_AP022608.1 | Mycolicibacterium gadium |
| 22 | 4841014 | 4841172 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 23 | 2242132 | 2242272 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 24 | 3294763 | 3294903 | - | NZ_CP029146.1 | Rhodococcus ruber |
| 25 | 2385072 | 2385230 | + | NZ_AP023172.1 | Rhodococcus qingshengii |
| 26 | 3848369 | 3848509 | - | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 27 | 3508994 | 3509134 | - | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 28 | 1691639 | 1691797 | + | NZ_AP023396.1 | Nocardia wallacei |
| 29 | 4317070 | 4317210 | + | NZ_LS483468.1 | Rhodococcus coprophilus |
| 30 | 1983486 | 1983644 | + | NZ_AP017900.1 | Nocardia seriolae |
| 31 | 3669112 | 3669255 | - | NC_013441.1 | Gordonia bronchialis DSM 43247 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP014955.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01668.20 | 0.97 | 29 | 1672 | same-strand | SmpB protein |
| 2 | PF18075.3 | 0.67 | 20 | 1998.0 | same-strand | FtsX extracellular domain |
| 3 | PF02687.23 | 0.67 | 20 | 1998.0 | same-strand | FtsX-like permease family |
| 4 | PF00005.29 | 0.63 | 19 | 2770 | same-strand | ABC transporter |
++ More..