Result : EXP02362
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02362 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 3470942 |
| Right | 3470992 |
| Strand | - |
| Nucleotide Sequence | GTGCTGTACTTCTCCGGTCAACTCGTAGTAGCAACCCGCAGCGGGGTCTGA |
| Sequence | VLYFSGQLVVATRSGV |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3473973 | 3474023 | - | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 2 | 3427461 | 3427511 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 3 | 3478256 | 3478306 | - | NZ_CP014955.1 | Mycobacteroides abscessus |
| 4 | 3687327 | 3687377 | - | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 5 | 3183463 | 3183513 | - | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 6 | 3248694 | 3248744 | - | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP007220.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00106.27 | 1.0 | 6 | 3738.0 | same-strand | short chain dehydrogenase |
| 2 | PF13561.8 | 1.0 | 6 | 3738.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 3 | PF08659.12 | 1.0 | 6 | 3738.0 | same-strand | KR domain |
| 4 | PF14257.8 | 1.0 | 6 | 2730.5 | opposite-strand | Domain of unknown function (DUF4349) |
| 5 | PF00067.24 | 1.0 | 6 | 541.5 | opposite-strand | Cytochrome P450 |
| 6 | PF02492.21 | 1.0 | 6 | 29.0 | same-strand | CobW/HypB/UreG, nucleotide-binding domain |
| 7 | PF07683.16 | 1.0 | 6 | 29.0 | same-strand | Cobalamin synthesis protein cobW C-terminal domain |
| 8 | PF13460.8 | 1.0 | 6 | 1156.0 | opposite-strand | NAD(P)H-binding |
| 9 | PF00296.22 | 0.83 | 5 | 1815 | same-strand | Luciferase-like monooxygenase |
| 10 | PF10604.11 | 0.83 | 5 | 2864 | opposite-strand | Polyketide cyclase / dehydrase and lipid transport |
| 11 | PF08281.14 | 0.83 | 5 | 3352 | same-strand | Sigma-70, region 4 |
| 12 | PF04542.16 | 0.83 | 5 | 3352 | same-strand | Sigma-70 region 2 |
| 13 | PF04545.18 | 0.83 | 5 | 3352 | same-strand | Sigma-70, region 4 |
++ More..