Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02360 |
NCBI Accession ID | CU458896.1 |
Organism | Mycobacterium abscessus ATCC 19977 |
Left | 2068378 |
Right | 2068428 |
Strand | - |
Nucleotide Sequence | GTGTTTATGGCGGGCTGTCCGCAACTCAACGCGATGCGCAGCGCCGCGTGA |
Sequence | VFMAGCPQLNAMRSAA |
Source of smORF | Ribo-seq |
Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
Pubmed ID | 34126767 27495169 |
Domain | |
Functional Category | Manually curated function from literature |
Uniprot ID | |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1373199 | 1373249 | - | NZ_AP022601.1 | Mycobacterium gallinarum |
2 | 2094769 | 2094819 | - | NZ_CP009360.4 | Mycobacterium avium subsp. hominissuis |
3 | 2075618 | 2075668 | - | NZ_CP014955.1 | Mycobacteroides abscessus |
4 | 3914460 | 3914510 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
5 | 1141034 | 1141084 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
6 | 2197733 | 2197783 | - | NZ_CP011530.1 | Mycobacteroides immunogenum |
7 | 2204806 | 2204856 | - | NZ_CP023147.1 | Mycobacterium marseillense |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00501.30 | 0.86 | 6 | 5945.0 | same-strand | AMP-binding enzyme |
2 | PF13193.8 | 0.71 | 5 | 5837 | same-strand | AMP-binding enzyme C-terminal domain |
3 | PF00441.26 | 0.86 | 6 | 4761.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
4 | PF02771.18 | 0.86 | 6 | 4761.0 | same-strand | Acyl-CoA dehydrogenase, N-terminal domain |
5 | PF02770.21 | 0.86 | 6 | 4761.0 | same-strand | Acyl-CoA dehydrogenase, middle domain |
6 | PF08028.13 | 0.86 | 6 | 4761.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
7 | PF02786.19 | 0.86 | 6 | 2670.0 | same-strand | Carbamoyl-phosphate synthase L chain, ATP binding domain |
8 | PF00289.24 | 0.86 | 6 | 2670.0 | same-strand | Biotin carboxylase, N-terminal domain |
9 | PF02785.21 | 0.86 | 6 | 2670.0 | same-strand | Biotin carboxylase C-terminal domain |
10 | PF00364.24 | 0.86 | 6 | 2670.0 | same-strand | Biotin-requiring enzyme |
11 | PF01039.24 | 0.86 | 6 | 1066.0 | same-strand | Carboxyl transferase domain |
12 | PF00440.25 | 1.0 | 7 | 0.0 | same-strand | Bacterial regulatory proteins, tetR family |
13 | PF10118.11 | 1.0 | 7 | 83 | opposite-strand | Predicted metal-dependent hydrolase |
14 | PF00106.27 | 0.86 | 6 | 2018.0 | opposite-strand | short chain dehydrogenase |
15 | PF13561.8 | 0.71 | 5 | 2018 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |