Result : EXP02359
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02359 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 742795 |
| Right | 742860 |
| Strand | - |
| Nucleotide Sequence | ATGCTCACGAAACGACGCGCCGTCGATCTGTGCCGCGTCGCGGGCTGCTGCTGTTGTTGCTGCTAA |
| Sequence | MLTKRRAVDLCRVAGCCCCCC |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 70
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 654312 | 654377 | - | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 2 | 3293554 | 3293628 | - | NZ_AP022568.1 | Mycobacterium simiae |
| 3 | 1396977 | 1397051 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 4 | 3283908 | 3283979 | + | NZ_AP022620.1 | Mycolicibacterium anyangense |
| 5 | 3716304 | 3716375 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
| 6 | 3595660 | 3595731 | + | NZ_AP022608.1 | Mycolicibacterium gadium |
| 7 | 859056 | 859124 | - | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 8 | 726116 | 726181 | - | NZ_CP014955.1 | Mycobacteroides abscessus |
| 9 | 698662 | 698727 | - | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 10 | 690570 | 690635 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 11 | 652790 | 652858 | - | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 12 | 695277 | 695345 | - | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 13 | 5454201 | 5454272 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 14 | 852456 | 852518 | - | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 15 | 1355111 | 1355173 | - | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 16 | 954405 | 954470 | - | NZ_CP029146.1 | Rhodococcus ruber |
| 17 | 2096239 | 2096304 | + | NZ_LS483468.1 | Rhodococcus coprophilus |
| 18 | 4627891 | 4627959 | + | NC_016906.1 | Gordonia polyisoprenivorans VH2 |
| 19 | 7107752 | 7107829 | - | NZ_AP022870.1 | Phytohabitans flavus |
| 20 | 3118531 | 3118608 | - | NZ_AP022871.1 | Phytohabitans suffuscus |
| 21 | 2517399 | 2517458 | + | NZ_CP033972.1 | Gordonia insulae |
| 22 | 7833799 | 7833867 | + | NZ_CP023865.1 | Actinoplanes teichomyceticus ATCC 31121 |
| 23 | 8864552 | 8864620 | - | NC_022657.1 | Actinoplanes friuliensis DSM 7358 |
| 24 | 338020 | 338091 | + | NC_009380.1 | Salinispora tropica CNB-440 |
| 25 | 6800816 | 6800893 | - | NZ_CP058322.1 | Micromonospora carbonacea |
| 26 | 8307214 | 8307282 | + | NC_017093.1 | Actinoplanes missouriensis 431 |
| 27 | 6382207 | 6382284 | - | NC_014391.1 | Micromonospora aurantiaca ATCC 27029 |
| 28 | 3987523 | 3987600 | + | NZ_CP061725.1 | Micromonospora craniellae |
| 29 | 5040348 | 5040425 | - | NZ_CP045309.1 | Micromonospora terminaliae |
| 30 | 534650 | 534724 | - | NZ_AP018920.1 | Pseudonocardia autotrophica |
| 31 | 5347553 | 5347627 | + | NZ_AP018920.1 | Pseudonocardia autotrophica |
| 32 | 5059525 | 5059596 | + | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 33 | 4966182 | 4966250 | - | NZ_AP022614.1 | Mycobacterium parmense |
| 34 | 499385 | 499459 | - | NC_015312.1 | Pseudonocardia dioxanivorans CB1190 |
| 35 | 2384594 | 2384647 | - | NC_013441.1 | Gordonia bronchialis DSM 43247 |
| 36 | 529270 | 529329 | + | NC_007777.1 | Frankia casuarinae |
| 37 | 628133 | 628210 | - | NZ_CP022744.1 | Streptomyces lincolnensis |
| 38 | 178821 | 178898 | - | NZ_CP045096.1 | Streptomyces phaeolivaceus |
| 39 | 1290353 | 1290430 | - | NZ_CP034463.1 | Streptomyces aquilus |
| 40 | 584561 | 584638 | - | NZ_CP015098.1 | Streptomyces qaidamensis |
| 41 | 594979 | 595056 | - | NZ_CP022310.1 | Streptomyces calvus |
| 42 | 6837482 | 6837556 | - | NZ_CP031142.1 | Saccharopolyspora pogona |
| 43 | 3153920 | 3153994 | + | NZ_CP061007.1 | Saccharopolyspora spinosa |
| 44 | 2347227 | 2347289 | - | NZ_CP054938.1 | Streptomyces harbinensis |
| 45 | 959131 | 959196 | + | NZ_CP022753.1 | Nocardiopsis gilva YIM 90087 |
| 46 | 4267745 | 4267810 | + | NZ_CP041091.1 | Nocardioides sambongensis |
| 47 | 9533926 | 9534000 | + | NZ_CP007155.1 | Kutzneria albida DSM 43870 |
| 48 | 1379742 | 1379807 | - | NZ_CP060713.1 | Nocardioides mesophilus |
| 49 | 1137143 | 1137205 | + | NZ_CP053564.1 | Pseudonocardia broussonetiae |
| 50 | 6850337 | 6850411 | + | NZ_CP016076.1 | Actinoalloteichus fjordicus |
| 51 | 6346660 | 6346734 | + | NZ_CP022521.1 | Actinoalloteichus hoggarensis |
| 52 | 2215801 | 2215866 | + | NZ_CP034550.1 | Saccharothrix syringae |
| 53 | 1529094 | 1529159 | + | NZ_AP022603.1 | Mycolicibacterium fallax |
| 54 | 381334 | 381399 | - | NZ_CP016174.1 | Amycolatopsis orientalis |
| 55 | 8580625 | 8580693 | + | NZ_CP008953.1 | Amycolatopsis japonica |
| 56 | 4927269 | 4927340 | + | NZ_CP022752.1 | Actinopolyspora erythraea |
| 57 | 7806669 | 7806731 | + | NC_014666.1 | Frankia inefficax |
| 58 | 4859387 | 4859461 | - | NC_013757.1 | Geodermatophilus obscurus DSM 43160 |
| 59 | 1007729 | 1007788 | + | NC_008278.1 | Frankia alni ACN14a |
| 60 | 8571922 | 8571990 | + | NC_021252.1 | Amycolatopsis keratiniphila |
| 61 | 1439452 | 1439520 | - | NZ_AP019307.1 | Nocardioides baekrokdamisoli |
| 62 | 6587287 | 6587352 | + | NZ_CP016353.1 | Prauserella marina |
| 63 | 3429944 | 3430009 | + | NZ_CP044344.1 | Nocardioides cynanchi |
| 64 | 6862535 | 6862609 | - | NZ_CP015163.1 | Amycolatopsis albispora |
| 65 | 3244825 | 3244896 | - | NZ_CP016793.1 | Lentzea guizhouensis |
| 66 | 3908633 | 3908698 | - | NZ_CP049257.1 | Nocardioides anomalus |
| 67 | 4121572 | 4121637 | - | NZ_CP059164.1 | Nocardioides ungokensis |
| 68 | 2146339 | 2146404 | + | NZ_CP038436.1 | Nocardioides seonyuensis |
| 69 | 55895 | 55972 | + | NZ_AP023355.1 | Actinocatenispora thailandica |
| 70 | 4606454 | 4606528 | + | NZ_CP045929.1 | Saccharopolyspora coralli |
| 71 | 762389 | 762448 | - | NZ_CP011853.1 | Gordonia phthalatica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP010271.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07210.14 | 0.86 | 60 | 1413.0 | same-strand | Protein of unknown function (DUF1416) |
| 2 | PF00581.22 | 0.84 | 59 | 575 | same-strand | Rhodanese-like domain |
| 3 | PF14340.8 | 0.64 | 45 | 96 | same-strand | Domain of unknown function (DUF4395) |
| 4 | PF11209.10 | 0.73 | 51 | 496 | same-strand | LmeA-like phospholipid-binding |
| 5 | PF00486.30 | 0.73 | 51 | 1592.0 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 6 | PF00583.27 | 0.66 | 46 | 2370.0 | opposite-strand | Acetyltransferase (GNAT) family |
++ More..