Result : EXP02357
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02357 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 5033652 |
| Right | 5033855 |
| Strand | + |
| Nucleotide Sequence | GTGGCTGGTCAGCGAACAGAAATCGCCGCTTTGGCGACGAGAGTTAATCACTCTGGTCACAATCCGGCCACTTCCGGGGGTGTCCGGGGTGGTTTCTCAGCTGCGGTTATTAACTTCGGGACCGCCACAACCGAGAGCCCCTCTGCGCTCCCCGTTGTCGCCCCAACCTCACACCACGCGCAGGACAGAGCCGGAAGGACATAG |
| Sequence | VAGQRTEIAALATRVNHSGHNPATSGGVRGGFSAAVINFGTATTESPSALPVVAPTSHHAQDRAGRT |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 67 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5040702 | 5040905 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 2 | 5543788 | 5544003 | + | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 3 | 4996450 | 4996656 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 4 | 4958765 | 4958971 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP011530.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01037.23 | 1.0 | 4 | 5032.0 | same-strand | Lrp/AsnC ligand binding domain |
| 2 | PF13404.8 | 1.0 | 4 | 5032.0 | same-strand | AsnC-type helix-turn-helix domain |
| 3 | PF13412.8 | 1.0 | 4 | 5032.0 | same-strand | Winged helix-turn-helix DNA-binding |
| 4 | PF00106.27 | 1.0 | 4 | 2890.5 | same-strand | short chain dehydrogenase |
| 5 | PF08659.12 | 1.0 | 4 | 2890.5 | same-strand | KR domain |
| 6 | PF13460.8 | 1.0 | 4 | 2890.5 | same-strand | NAD(P)H-binding |
| 7 | PF13603.8 | 1.0 | 4 | 46.0 | opposite-strand | Leucyl-tRNA synthetase, Domain 2 |
| 8 | PF08264.15 | 1.0 | 4 | 46.0 | opposite-strand | Anticodon-binding domain of tRNA ligase |
| 9 | PF10738.11 | 1.0 | 4 | 0.5 | same-strand | Probable lipoprotein LpqN |
| 10 | PF14337.8 | 1.0 | 4 | 2945.5 | same-strand | Abortive infection alpha |
| 11 | PF02622.17 | 1.0 | 4 | 3759.5 | opposite-strand | Uncharacterized ACR, COG1678 |
| 12 | PF00676.22 | 0.75 | 3 | 5669 | opposite-strand | Dehydrogenase E1 component |
++ More..