Result : EXP02356
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02356 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 3587531 |
| Right | 3587605 |
| Strand | + |
| Nucleotide Sequence | ATGGCCAAGCGTGGTCGTAAGAAGCGCAGCCGCAAGCACAACGCCGCCAACCACGGCAAGCGTCCCAACAGCTAG |
| Sequence | MAKRGRKKRSRKHNAANHGKRPNS |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 20
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4023296 | 4023370 | + | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 2 | 3594845 | 3594919 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 3 | 3322474 | 3322548 | + | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 4 | 3624635 | 3624709 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 5 | 3662349 | 3662423 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 6 | 3390887 | 3390961 | + | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 7 | 81553 | 81627 | + | NZ_CP033719.1 | Propionibacterium acidifaciens |
| 8 | 442343 | 442417 | + | NC_014246.1 | Mobiluncus curtisii ATCC 43063 |
| 9 | 2548021 | 2548095 | + | NC_015588.1 | Isoptericola variabilis 225 |
| 10 | 3694143 | 3694217 | - | NZ_CP014209.1 | Isoptericola dokdonensis DS-3 |
| 11 | 6748205 | 6748279 | - | NC_013131.1 | Catenulispora acidiphila DSM 44928 |
| 12 | 5164490 | 5164564 | - | NZ_CP034279.1 | Streptomyces ficellus |
| 13 | 3850992 | 3851066 | + | NC_015564.1 | Hoyosella subflava DQS3-9A1 |
| 14 | 561065 | 561139 | - | NZ_CP007790.1 | Corynebacterium marinum DSM 44953 |
| 15 | 3680033 | 3680107 | + | NZ_CP029196.1 | Streptomyces venezuelae |
| 16 | 3051961 | 3052035 | - | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 17 | 3791732 | 3791806 | + | NZ_CP023693.1 | Streptomyces cinereoruber |
| 18 | 1830309 | 1830383 | - | NZ_CP023696.1 | Streptomyces fradiae ATCC 10745 = DSM 40063 |
| 19 | 1743385 | 1743459 | - | NZ_CP017316.1 | Streptomyces rubrolavendulae |
| 20 | 1997174 | 1997248 | + | NZ_CP040752.1 | Streptomyces rectiverticillatus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP011530.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04542.16 | 0.6 | 12 | 320.0 | opposite-strand | Sigma-70 region 2 |
| 2 | PF08281.14 | 0.6 | 12 | 320.0 | opposite-strand | Sigma-70, region 4 |
| 3 | PF04545.18 | 0.6 | 12 | 320.0 | opposite-strand | Sigma-70, region 4 |
++ More..