Result : EXP02355
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02355 |
| NCBI Accession ID | CU458896.1 |
| Organism | Mycobacterium abscessus ATCC 19977 |
| Left | 2352709 |
| Right | 2352786 |
| Strand | + |
| Nucleotide Sequence | ATGAACCGGCGAAGTGGACGGACGCCCCGCGTGCTGACTAACTCCGCAAAAACAACACGGTGTCGTACTGGCTGGTAG |
| Sequence | MNRRSGRTPRVLTNSAKTTRCRTGW |
| Source of smORF | Ribo-seq |
| Function | The genomic region encoding this ORF has been found to confer the bacterium with a growth advantage when mutated in a transposon mutagenesis screen by Rifat et al. Pubmed:34126767,27495169 |
| Pubmed ID | 34126767 27495169 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2359949 | 2360026 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 2 | 2299769 | 2299846 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 3 | 2329029 | 2329106 | - | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 4 | 2060303 | 2060380 | + | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 5 | 2228653 | 2228730 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 6 | 2489328 | 2489405 | + | NZ_CP011530.1 | Mycobacteroides immunogenum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP010271.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01121.22 | 1.0 | 6 | 5012.0 | same-strand | Dephospho-CoA kinase |
| 2 | PF04229.16 | 1.0 | 6 | 5012.0 | same-strand | GrpB protein |
| 3 | PF13238.8 | 1.0 | 6 | 5012.0 | same-strand | AAA domain |
| 4 | PF17929.3 | 1.0 | 6 | 4340.5 | opposite-strand | Tetracyclin repressor-like, C-terminal domain |
| 5 | PF00440.25 | 1.0 | 6 | 4340.5 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 6 | PF05423.15 | 1.0 | 6 | 141 | same-strand | Mycobacterium membrane protein |
| 7 | PF03176.17 | 1.0 | 6 | 538.5 | same-strand | MMPL family |
| 8 | PF16877.7 | 1.0 | 6 | 3650.5 | opposite-strand | Domain of unknown function (DUF5078) |
| 9 | PF01408.24 | 1.0 | 6 | 4636.5 | opposite-strand | Oxidoreductase family, NAD-binding Rossmann fold |
| 10 | PF02894.19 | 0.83 | 5 | 4638 | opposite-strand | Oxidoreductase family, C-terminal alpha/beta domain |
| 11 | PF00575.25 | 0.83 | 5 | 6342 | same-strand | S1 RNA binding domain |
| 12 | PF13671.8 | 0.83 | 5 | 4999 | same-strand | AAA domain |
++ More..