Result : EXP02340
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02340 |
| NCBI Accession ID | NC_005956.1 |
| Organism | Bartonella henselae str. Houston-1 |
| Left | 842169 |
| Right | 842240 |
| Strand | + |
| Nucleotide Sequence | ATGACGATGAAGAACGAGAGTTTCTTTACCGAGGTATTGCTTCGCGTGCTTTTGAACGGCGTTTTCATTTAG |
| Sequence | MTMKNESFFTEVLLRVLLNGVFI |
| Source of smORF | Protein-level |
| Function | The localisation of the protein was found to be: Inner Membrane exclusive. Pubmed:29141959 |
| Pubmed ID | 29141959 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 836369 | 836440 | + | NZ_HG965802.1 | Bartonella henselae |
| 2 | 1632406 | 1632483 | - | NZ_CP031843.2 | Bartonella kosoyi |
| 3 | 746030 | 746107 | + | NZ_LR134527.1 | Bartonella elizabethae |
| 4 | 1141185 | 1141250 | - | NZ_CP031844.2 | Bartonella krasnovii |
| 5 | 938116 | 938187 | - | NC_014932.1 | Bartonella clarridgeiae 73 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP031843.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00072.26 | 1.0 | 5 | 2207 | opposite-strand | Response regulator receiver domain |
| 2 | PF12146.10 | 1.0 | 5 | 526 | opposite-strand | Serine aminopeptidase, S33 |
| 3 | PF00011.23 | 1.0 | 5 | -71 | same-strand | Hsp20/alpha crystallin family |
| 4 | PF01521.22 | 1.0 | 5 | 1045 | same-strand | Iron-sulphur cluster biosynthesis |
| 5 | PF03819.19 | 1.0 | 5 | 1526 | opposite-strand | MazG nucleotide pyrophosphohydrolase domain |
| 6 | PF03279.15 | 1.0 | 5 | 2321 | opposite-strand | Bacterial lipid A biosynthesis acyltransferase |
| 7 | PF00107.28 | 1.0 | 5 | 3257 | opposite-strand | Zinc-binding dehydrogenase |
| 8 | PF08240.14 | 1.0 | 5 | 3257 | opposite-strand | Alcohol dehydrogenase GroES-like domain |
| 9 | PF13602.8 | 1.0 | 5 | 3257 | opposite-strand | Zinc-binding dehydrogenase |
| 10 | PF01503.19 | 0.6 | 3 | 1482 | opposite-strand | Phosphoribosyl-ATP pyrophosphohydrolase |
++ More..