Result : EXP02338
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02338 |
| NCBI Accession ID | NC_005956.1 |
| Organism | Bartonella henselae str. Houston-1 |
| Left | 209240 |
| Right | 209308 |
| Strand | + |
| Nucleotide Sequence | ATGTTGCTGATGGTAGTATTTCCAAGGATTCACGTGATGCCATCAATGGTAGCCAAATTTATTCTCTGA |
| Sequence | MLLMVVFPRIHVMPSMVAKFIL |
| Source of smORF | Protein-level |
| Function | The localisation of the protein was found to be: Inner Membrane exclusive. Pubmed:29141959 |
| Pubmed ID | 29141959 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 207835 | 207903 | + | NZ_HG965802.1 | Bartonella henselae |
| 2 | 209245 | 209313 | + | NZ_HG965802.1 | Bartonella henselae |
| 3 | 212986 | 213054 | + | NZ_HG965802.1 | Bartonella henselae |
| 4 | 210214 | 210282 | + | NC_012846.1 | Bartonella grahamii as4aup |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_HG965802.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05662.16 | 1.0 | 2 | 1986.0 | same-strand | Coiled stalk of trimeric autotransporter adhesin |
| 2 | PF05658.16 | 1.0 | 2 | 1986.0 | same-strand | Head domain of trimeric autotransporter adhesin |
| 3 | PF03895.17 | 1.0 | 2 | 4329.0 | same-strand | YadA-like membrane anchor domain |
++ More..