Result : EXP02319
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02319 |
| NCBI Accession ID | NC_009641.1 |
| Organism | Staphylococcus aureus subsp. aureus str. Newman |
| Left | 2592131 |
| Right | 2592388 |
| Strand | - |
| Nucleotide Sequence | ATGATTATCACTAGCCCTACAGAAGCGAGAAAAGATTTTTATCAATTACTAAAAAATGTTAATAATAATCACGAACCAATTTATATTAGTGGCAATAATGCCGAAAATAATGCTGTGATTATAGGTTTAGAAGATTGGAAAAGTATACAAGAGACAATATATCTTGAATCTACTGGTACAATGGACAAAGTAAGAGAAAGAGAAAAAGATAATAGTGGTACAACAAATATAGATGATATTGATTGGGATAATCTTTAA |
| Sequence | MIITSPTEARKDFYQLLKNVNNNHEPIYISGNNAENNAVIIGLEDWKSIQETIYLESTGTMDKVREREKDNSGTTNIDDIDWDNL |
| Source of smORF | Protein-level |
| Function | The ORF matches to the profile of cl09153. Profile Description: Antitoxin Phd_YefM, type II toxin-antitoxin system. This model recognizes a region of about 55 amino acids toward the N-terminal end of bacterial proteins of about 85 amino acids in length. The best-characterized member is prevent-host-death (phd) of bacteriophage P1, the antidote partner of death-on-curing (doc) (TIGR01550) in an addiction module. Addiction modules prevent plasmid curing by killing the host cell as the longer-lived killing protein persists while the gene for the shorter-lived antidote is lost. Note, however, that relatively few members of this family appear to be plasmid or phage-encoded. Also, there is little overlap, except for phage P1 itself, of species with this family and with the doc family. [Cellular processes, Toxin production and resistance, Mobile and extrachromosomal element functions, Other] |
| Pubmed ID | 34061833 |
| Domain | CDD:415595 |
| Functional Category | Conserved domain based functional assignment |
| Uniprot ID | |
| ORF Length (Amino Acid) | 85 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2534300 | 2534557 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 2 | 2493202 | 2493459 | - | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 3 | 23286 | 23543 | + | NZ_CP007602.1 | Staphylococcus capitis subsp. capitis |
| 4 | 2378239 | 2378496 | - | NZ_LT906460.1 | Staphylococcus simiae |
| 5 | 2440221 | 2440478 | - | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 6 | 852811 | 853068 | - | NZ_CP027770.1 | Staphylococcus felis |
| 7 | 883008 | 883265 | + | NZ_CP011366.1 | Salinicoccus halodurans |
| 8 | 188596 | 188805 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 9 | 216144 | 216353 | + | NZ_CP065211.1 | Enterococcus lactis |
| 10 | 451462 | 451671 | + | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 11 | 1200 | 1409 | - | NC_020208.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 12 | 58854 | 59108 | + | NZ_AP022823.1 | Enterococcus saigonensis |
| 13 | 631491 | 631724 | + | NZ_CP012047.1 | Tetragenococcus halophilus |
| 14 | 2150763 | 2151020 | + | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 15 | 1098178 | 1098444 | - | NZ_CP061341.1 | Lactobacillus kefiranofaciens |
| 16 | 1329453 | 1329665 | + | NZ_CP018061.1 | Enterococcus mundtii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007795.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05016.17 | 0.67 | 10 | 0 | same-strand | ParE toxin of type II toxin-antitoxin system, parDE |
++ More..