Result : EXP02260
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02260 |
| NCBI Accession ID | NC_009641.1 |
| Organism | Staphylococcus aureus subsp. aureus str. Newman |
| Left | 1351624 |
| Right | 1351815 |
| Strand | + |
| Nucleotide Sequence | ATGAATTTACAGTCATACATAGGCAAATTAGTCAAATTAACGCTTACTAATAATAAAATATTAATTGGAAAAGTGATAGACTTTGATGATAAAGTTGATAATTTTGATGGTTATAATTCGATAGAAATTGATACAGGTAGAATTACATATGATATATCAGAAAATAAAATTAAAACTATTGTTTTACAATAA |
| Sequence | MNLQSYIGKLVKLTLTNNKILIGKVIDFDDKVDNFDGYNSIEIDTGRITYDISENKIKTIVLQ |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 34061833 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 63 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1251668 | 1251859 | + | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 2 | 1331254 | 1331445 | + | NZ_LR134304.1 | Staphylococcus schweitzeri |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_007795.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF15542.8 | 1.0 | 2 | 7 | same-strand | Bacterial toxin 50 |
++ More..