Result : EXP02250

Protein Information

• Protein name: EXP02250
• NCBI Accession ID: NC_009641.1
• Organism: Staphylococcus aureus subsp. aureus str. Newman
• Left: 2465328
• Right: 2465414
• Strand: +
• Nucleotide Sequence: ATGATGCCTCTAATGTTTGTTAAATCTGGTAGTGTTGTTTCTGATTCAATGACAACTTTCTTGTTACCATTAGATGCACGTACATGA
• Sequence: MMPLMFVKSGSVVSDSMTTFLLPLDART
• Source of smORF: Protein-level
• Pubmed ID: 34061833
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 28

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2407492	2407578	+	NC_007795.1	Staphylococcus aureus subsp. aureus NCTC 8325
2	2366487	2366573	+	NZ_LR134304.1	Staphylococcus schweitzeri

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_007795.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03473.19	1.0	2	3234.0	same-strand	MOSC domain
2	PF03475.16	1.0	2	3234.0	same-strand	3-alpha domain
3	PF01263.22	1.0	2	1969.5	opposite-strand	Aldose 1-epimerase
4	PF02694.17	1.0	2	1613.5	opposite-strand	Uncharacterised BCR, YnfA/UPF0060 family
5	PF12698.9	1.0	2	163.5	opposite-strand	ABC-2 family transporter protein
6	PF00005.29	1.0	2	-86.0	opposite-strand	ABC transporter
7	PF13732.8	1.0	2	-86.0	opposite-strand	Domain of unknown function (DUF4162)
8	PF05656.16	1.0	2	872.5	opposite-strand	Protein of unknown function (DUF805)
9	PF02245.18	1.0	2	1913.0	same-strand	Methylpurine-DNA glycosylase (MPG)
10	PF03616.16	1.0	2	2916.5	same-strand	Sodium/glutamate symporter