Result : EXP02243
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02243 |
| NCBI Accession ID | CP001363.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 1920620 |
| Right | 1920757 |
| Strand | - |
| Nucleotide Sequence | ATGTCTGAACGTCCTGATTTAGTCGATCCATTACCAGAGGATGAGCCGCTTCCTGGTGAAAATATTCCGGATACACCAGAGGGAGACGATCCTCTCGACCCGGATACCCAGAATGAGGTTGAAGATCCTCGTAGATAG |
| Sequence | MSERPDLVDPLPEDEPLPGENIPDTPEGDDPLDPDTQNEVEDPRR |
| Source of smORF | Protein-level |
| Function | The protein encoded by this ORF is under the control of the RNA Polymerase sigma factor RpoS which plays a role in general stress response. It is abundantly expressed in the stationary phase. Pubmed:28522802 |
| Pubmed ID | 28522802 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 45 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1909925 | 1910062 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 4420710 | 4420847 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2048293 | 2048427 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 4 | 2519033 | 2519170 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
++ More..