| Protein name |
EXP02228 |
| NCBI Accession ID |
CP039126.1 |
| Organism |
Blautia producta strain DSM 2950 |
| Left |
3946687 |
| Right |
3946887 |
| Strand |
+ |
| Nucleotide Sequence |
ATGGGTATTAAAGTAAAAGTAAATTTTGACAAACGGAAATTAGAGTCTGCCATCAAGGACCAGGCAAGAGAATCTCTCCGCAATCGTTCATATGATGCAAAATGTCCATTTTGTCATACAACTTTTAGTGCTCATCCGGGGCCAAATGTCTGTCCCCATTGCCGTAAGACTGTTGATCTAAATCTTAACATCAAGCTTTAA |
| Sequence |
MGIKVKVNFDKRKLESAIKDQARESLRNRSYDAKCPFCHTTFSAHPGPNVCPHCRKTVDLNLNIKL |
| Source of smORF |
Protein-level |
| Function |
Expressed by the bacterium uniquely when cultured in the SIHUMIx community(simplified human intestinal microbiota) as compared to when it is cultivated as a single strain. This suggests a plausible role in the community organisation. Pubmed:33622394 |
| Pubmed ID |
33622394
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
66 |