| Protein name |
EXP02215 |
| NCBI Accession ID |
CP036346.1 |
| Organism |
Erysipelatoclostridium ramosum DSM 1402 |
| Left |
1794176 |
| Right |
1794271 |
| Strand |
+ |
| Nucleotide Sequence |
ATGAAAAAAATAATAAAACCTATTCAACCAATAAAACCAAGCCCACCAACAAAAAACAAACCAAAAAATTCTTCAATTAAAAAGCCATCTAAATAA |
| Sequence |
MKKIIKPIQPIKPSPPTKNKPKNSSIKKPSK |
| Source of smORF |
Protein-level |
| Function |
Expressed by the bacterium uniquely when cultured in the SIHUMIx community(simplified human intestinal microbiota) as compared to when it is cultivated as a single strain. This suggests a plausible role in the community organisation. Pubmed:33622394 |
| Pubmed ID |
33622394
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
31 |