Result : EXP02205
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02205 |
| NCBI Accession ID | NC_002947.3 |
| Organism | Pseudomonas putida KT2440 |
| Left | 4022699 |
| Right | 4022806 |
| Strand | - |
| Nucleotide Sequence | ATGGATGCCCGTCAAGCGCTGGGCCCCAGGATGGGGCCTGCAGCGCGGTCCTCCCGGGAGCAAGCCCGGAGCGAGGGAACCCCGGAGCGTAGCGCAGGGGCCGGATGA |
| Sequence | MDARQALGPRMGPAARSSREQARSEGTPERSAGAG |
| Source of smORF | Protein-level |
| Function | |
| Pubmed ID | 27717237 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 35 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4653440 | 4653547 | - | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 2 | 4407171 | 4407278 | - | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 3 | 5159065 | 5159172 | - | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 4 | 4666743 | 4666850 | - | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 5 | 4654180 | 4654287 | - | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 6 | 4096756 | 4096863 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 7 | 4653807 | 4653914 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 8 | 4653067 | 4653174 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 9 | 5158696 | 5158803 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 10 | 4244604 | 4244711 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 11 | 4666373 | 4666480 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 12 | 4406800 | 4406907 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 13 | 2660968 | 2661075 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 14 | 2632115 | 2632222 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 15 | 3799572 | 3799679 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 16 | 1334833 | 1334940 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 17 | 3284430 | 3284537 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 18 | 5153032 | 5153139 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 19 | 3799103 | 3799210 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 20 | 4342511 | 4342618 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 21 | 3328909 | 3329016 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 22 | 4257474 | 4257581 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 23 | 2597161 | 2597268 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 24 | 877926 | 878033 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 25 | 2632525 | 2632632 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 26 | 474324 | 474431 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 27 | 2661438 | 2661545 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 28 | 3283951 | 3284058 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 29 | 3830519 | 3830626 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 30 | 4342919 | 4343026 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 31 | 3328515 | 3328622 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 32 | 1804146 | 1804253 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 33 | 1335231 | 1335338 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 34 | 2907003 | 2907110 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 35 | 3858882 | 3858989 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 36 | 3383863 | 3383970 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 37 | 2086110 | 2086217 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 38 | 2721383 | 2721490 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 39 | 612115 | 612222 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 40 | 4634028 | 4634135 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 41 | 1775022 | 1775129 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 42 | 4020437 | 4020544 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 43 | 1774633 | 1774740 | - | NZ_CP024159.1 | Pseudomonas mosselii |
| 44 | 1039883 | 1039990 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 45 | 909577 | 909684 | - | NZ_CP022562.1 | Pseudomonas monteilii |
| 46 | 1967176 | 1967283 | + | NZ_CP009365.1 | Pseudomonas soli |
| 47 | 2606572 | 2606679 | - | NZ_CP009365.1 | Pseudomonas soli |
| 48 | 3108210 | 3108317 | - | NZ_CP009365.1 | Pseudomonas soli |
| 49 | 2329118 | 2329225 | - | NZ_CP009365.1 | Pseudomonas soli |
| 50 | 1734663 | 1734770 | + | NZ_CP009365.1 | Pseudomonas soli |
| 51 | 3167445 | 3167552 | - | NZ_CP009365.1 | Pseudomonas soli |
| 52 | 4432554 | 4432661 | - | NZ_CP009365.1 | Pseudomonas soli |
| 53 | 1213710 | 1213817 | - | NZ_CP009365.1 | Pseudomonas soli |
| 54 | 1358158 | 1358265 | - | NZ_CP009365.1 | Pseudomonas soli |
| 55 | 1358620 | 1358727 | + | NZ_CP009365.1 | Pseudomonas soli |
| 56 | 3240530 | 3240637 | - | NZ_CP009365.1 | Pseudomonas soli |
| 57 | 1214203 | 1214310 | + | NZ_CP009365.1 | Pseudomonas soli |
| 58 | 3549417 | 3549524 | - | NZ_CP009365.1 | Pseudomonas soli |
| 59 | 3188792 | 3188899 | - | NZ_CP009365.1 | Pseudomonas soli |
| 60 | 6224400 | 6224486 | + | NZ_CP009365.1 | Pseudomonas soli |
| 61 | 3699672 | 3699758 | - | NZ_CP009365.1 | Pseudomonas soli |
| 62 | 2418810 | 2418896 | - | NZ_CP009365.1 | Pseudomonas soli |
| 63 | 2361825 | 2361911 | - | NZ_CP009365.1 | Pseudomonas soli |
| 64 | 3139235 | 3139342 | - | NZ_CP009365.1 | Pseudomonas soli |
| 65 | 897027 | 897134 | + | NZ_CP009365.1 | Pseudomonas soli |
| 66 | 3854339 | 3854446 | - | NZ_CP009365.1 | Pseudomonas soli |
| 67 | 3023422 | 3023529 | - | NC_008027.1 | Pseudomonas entomophila L48 |
| 68 | 3430436 | 3430543 | - | NC_008027.1 | Pseudomonas entomophila L48 |
| 69 | 1722988 | 1723095 | + | NC_008027.1 | Pseudomonas entomophila L48 |
| 70 | 1159993 | 1160100 | + | NC_008027.1 | Pseudomonas entomophila L48 |
| 71 | 4531093 | 4531200 | - | NC_008027.1 | Pseudomonas entomophila L48 |
| 72 | 2487857 | 2487964 | + | NC_008027.1 | Pseudomonas entomophila L48 |
| 73 | 1313480 | 1313587 | + | NC_008027.1 | Pseudomonas entomophila L48 |
| 74 | 3938275 | 3938382 | - | NC_008027.1 | Pseudomonas entomophila L48 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_021505.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03466.22 | 0.8 | 4 | 1361.5 | both-strands | LysR substrate binding domain |
| 2 | PF00126.29 | 0.8 | 4 | 1361.5 | both-strands | Bacterial regulatory helix-turn-helix protein, lysR family |
| 3 | PF07690.18 | 0.8 | 4 | 1653.5 | both-strands | Major Facilitator Superfamily |
| 4 | PF07883.13 | 0.6 | 3 | 2696.5 | opposite-strand | Cupin domain |
| 5 | PF00440.25 | 0.8 | 4 | 371.5 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 6 | PF01177.24 | 0.8 | 4 | 4192 | opposite-strand | Asp/Glu/Hydantoin racemase |
| 7 | PF00899.23 | 0.6 | 3 | 3628.5 | both-strands | ThiF family |
| 8 | PF17827.3 | 0.6 | 3 | 2804.5 | both-strands | PrmC N-terminal domain |
| 9 | PF03462.20 | 0.8 | 4 | 1906 | same-strand | PCRF domain |
| 10 | PF00472.22 | 0.8 | 4 | 1906 | same-strand | RF-1 domain |
| 11 | PF05201.17 | 0.6 | 3 | 448.0 | both-strands | Glutamyl-tRNAGlu reductase, N-terminal domain |
| 12 | PF01488.22 | 0.6 | 3 | 448.0 | both-strands | Shikimate / quinate 5-dehydrogenase |
| 13 | PF00745.22 | 0.6 | 3 | 448.0 | both-strands | Glutamyl-tRNAGlu reductase, dimerisation domain |
| 14 | PF13428.8 | 0.6 | 3 | 649 | opposite-strand | Tetratricopeptide repeat |
| 15 | PF13432.8 | 0.8 | 4 | 673.0 | opposite-strand | Tetratricopeptide repeat |
| 16 | PF07719.19 | 1.0 | 5 | 697 | opposite-strand | Tetratricopeptide repeat |
| 17 | PF13424.8 | 0.6 | 3 | 479.0 | both-strands | Tetratricopeptide repeat |
| 18 | PF03550.16 | 0.6 | 3 | 2204.5 | both-strands | Outer membrane lipoprotein LolB |
| 19 | PF00288.28 | 0.6 | 3 | 2826.5 | both-strands | GHMP kinases N terminal domain |
| 20 | PF13793.8 | 0.6 | 3 | 3838.0 | both-strands | N-terminal domain of ribose phosphate pyrophosphokinase |
| 21 | PF01386.21 | 0.6 | 3 | 4891.5 | both-strands | Ribosomal L25p family |
| 22 | PF14693.8 | 0.6 | 3 | 4891.5 | both-strands | Ribosomal protein TL5, C-terminal domain |
| 23 | PF00378.22 | 0.6 | 3 | 1892.5 | both-strands | Enoyl-CoA hydratase/isomerase |
| 24 | PF00108.25 | 0.6 | 3 | 1938.5 | opposite-strand | Thiolase, N-terminal domain |
| 25 | PF02803.20 | 0.6 | 3 | 1938.5 | opposite-strand | Thiolase, C-terminal domain |
| 26 | PF00015.23 | 0.6 | 3 | 2707 | opposite-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
| 27 | PF00672.27 | 0.6 | 3 | 2378 | opposite-strand | HAMP domain |
| 28 | PF00005.29 | 0.6 | 3 | 2062.0 | both-strands | ABC transporter |
| 29 | PF00330.22 | 0.8 | 4 | 3583 | same-strand | Aconitase family (aconitate hydratase) |
| 30 | PF00694.21 | 0.8 | 4 | 2942 | same-strand | Aconitase C-terminal domain |
| 31 | PF08447.14 | 0.6 | 3 | 453.0 | same-strand | PAS fold |
| 32 | PF13426.9 | 0.6 | 3 | 640 | same-strand | PAS domain |
| 33 | PF08448.12 | 0.6 | 3 | 2188 | same-strand | PAS fold |
| 34 | PF13533.8 | 0.6 | 3 | 4020.0 | same-strand | Biotin-lipoyl like |
| 35 | PF16576.7 | 0.6 | 3 | 5757 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 36 | PF00873.21 | 0.6 | 3 | 2101 | same-strand | AcrB/AcrD/AcrF family |
| 37 | PF13437.8 | 0.6 | 3 | 3182 | same-strand | HlyD family secretion protein |
| 38 | PF02518.28 | 0.6 | 3 | 2517.5 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 39 | PF00072.26 | 0.6 | 3 | 3739 | same-strand | Response regulator receiver domain |
| 40 | PF00512.27 | 0.6 | 3 | 2517.5 | same-strand | His Kinase A (phospho-acceptor) domain |
| 41 | PF00497.22 | 0.6 | 3 | 2054 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 42 | PF00990.23 | 0.6 | 3 | 266 | same-strand | Diguanylate cyclase, GGDEF domain |
| 43 | PF00691.22 | 0.6 | 3 | 2110 | same-strand | OmpA family |
| 44 | PF13520.8 | 0.6 | 3 | 2168.0 | same-strand | Amino acid permease |
| 45 | PF00324.23 | 0.6 | 3 | 2168.0 | same-strand | Amino acid permease |
| 46 | PF12625.9 | 0.6 | 3 | 3499 | opposite-strand | Arabinose-binding domain of AraC transcription regulator, N-term |
| 47 | PF12833.9 | 0.6 | 3 | 3547.0 | opposite-strand | Helix-turn-helix domain |
| 48 | PF01266.26 | 0.6 | 3 | 2685.0 | both-strands | FAD dependent oxidoreductase |
| 49 | PF03692.17 | 0.6 | 3 | 3511.0 | same-strand | Putative zinc- or iron-chelating domain |
| 50 | PF13649.8 | 0.6 | 3 | 1113 | same-strand | Methyltransferase domain |
| 51 | PF08241.14 | 0.6 | 3 | 1113 | same-strand | Methyltransferase domain |
| 52 | PF08242.14 | 0.6 | 3 | 1113 | same-strand | Methyltransferase domain |
| 53 | PF00392.23 | 0.6 | 3 | 3205 | same-strand | Bacterial regulatory proteins, gntR family |
| 54 | PF00515.30 | 0.6 | 3 | 3934 | opposite-strand | Tetratricopeptide repeat |
| 55 | PF13181.8 | 0.6 | 3 | 3934 | opposite-strand | Tetratricopeptide repeat |
| 56 | PF00155.23 | 0.6 | 3 | 2119 | same-strand | Aminotransferase class I and II |
| 57 | PF14346.8 | 0.6 | 3 | 642.0 | same-strand | Domain of unknown function (DUF4398) |
| 58 | PF01012.23 | 0.6 | 3 | 2777.0 | same-strand | Electron transfer flavoprotein domain |
| 59 | PF00766.21 | 0.6 | 3 | 2335 | same-strand | Electron transfer flavoprotein FAD-binding domain |
| 60 | PF10861.10 | 0.6 | 3 | 652.0 | opposite-strand | Protein of Unknown function (DUF2784) |
| 61 | PF00180.22 | 0.6 | 3 | 1895.5 | same-strand | Isocitrate/isopropylmalate dehydrogenase |
| 62 | PF02774.20 | 0.6 | 3 | 653 | same-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 63 | PF01118.26 | 0.6 | 3 | 653 | same-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 64 | PF04828.16 | 0.6 | 3 | 2550.0 | same-strand | Glutathione-dependent formaldehyde-activating enzyme |
++ More..