Result : EXP02165
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02165 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4601014 |
| Right | 4601058 |
| Strand | - |
| Nucleotide Sequence | ATGTCTTCCTTTTCTAGCCAATGTTGTTTGTGTATAGCAACTTAA |
| Sequence | MSSFSSQCCLCIAT |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4580449 | 4580493 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2360574 | 2360618 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13698.8 | 1.0 | 2 | 3075.0 | opposite-strand | Domain of unknown function (DUF4156) |
| 2 | PF15922.7 | 1.0 | 2 | 2170.0 | same-strand | YjeJ-like |
| 3 | PF04055.23 | 1.0 | 2 | 859.0 | same-strand | Radical SAM superfamily |
| 4 | PF09285.13 | 1.0 | 2 | 252.0 | opposite-strand | Elongation factor P, C-terminal |
| 5 | PF08207.14 | 1.0 | 2 | 252.0 | opposite-strand | Elongation factor P (EF-P) KOW-like domain |
| 6 | PF01132.22 | 1.0 | 2 | 252.0 | opposite-strand | Elongation factor P (EF-P) OB domain |
| 7 | PF08085.13 | 1.0 | 2 | 32.0 | opposite-strand | Entericidin EcnA/B family |
| 8 | PF00196.21 | 1.0 | 2 | 178.5 | same-strand | Bacterial regulatory proteins, luxR family |
| 9 | PF08281.14 | 1.0 | 2 | 178.5 | same-strand | Sigma-70, region 4 |
| 10 | PF00893.21 | 1.0 | 2 | 1023.0 | opposite-strand | Small Multidrug Resistance protein |
| 11 | PF08212.14 | 1.0 | 2 | 1358.0 | same-strand | Lipocalin-like domain |
| 12 | PF00061.25 | 1.0 | 2 | 1358.0 | same-strand | Lipocalin / cytosolic fatty-acid binding protein family |
| 13 | PF02313.19 | 1.0 | 2 | 2002.5 | same-strand | Fumarate reductase subunit D |
++ More..