Result : EXP02164
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02164 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4318309 |
| Right | 4318362 |
| Strand | - |
| Nucleotide Sequence | ATGATTCAATTCACTCTCTTCTGCTGTCTCAAAATGCGCTTCATGGCGCGATAA |
| Sequence | MIQFTLFCCLKMRFMAR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4296884 | 4296937 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2075421 | 2075474 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2847912 | 2847965 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05656.16 | 0.67 | 2 | 4598.5 | opposite-strand | Protein of unknown function (DUF805) |
| 2 | PF00175.23 | 0.67 | 2 | 3747.5 | same-strand | Oxidoreductase NAD-binding domain |
| 3 | PF03320.15 | 1.0 | 3 | 2641 | same-strand | Bacterial fructose-1,6-bisphosphatase, glpX-encoded |
| 4 | PF00370.23 | 1.0 | 3 | 1021 | same-strand | FGGY family of carbohydrate kinases, N-terminal domain |
| 5 | PF02782.18 | 1.0 | 3 | 1021 | same-strand | FGGY family of carbohydrate kinases, C-terminal domain |
| 6 | PF00230.22 | 1.0 | 3 | 155 | same-strand | Major intrinsic protein |
| 7 | PF06005.14 | 1.0 | 3 | 191 | opposite-strand | Cell division protein ZapB |
| 8 | PF03737.17 | 1.0 | 3 | 652 | same-strand | Aldolase/RraA |
| 9 | PF01040.20 | 1.0 | 3 | 1230 | same-strand | UbiA prenyltransferase family |
| 10 | PF07724.16 | 1.0 | 3 | 2223 | same-strand | AAA domain (Cdc48 subfamily) |
| 11 | PF00227.28 | 1.0 | 3 | 3564 | same-strand | Proteasome subunit |
++ More..