Result : EXP02163
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02163 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4070944 |
| Right | 4071024 |
| Strand | - |
| Nucleotide Sequence | ATGGGGACAATTCAGGACACAAAAATCGCGGATGAACCCGCACGACTATGGACGAGTATGGAAAGTAAAAACCCGCGTTAA |
| Sequence | MGTIQDTKIADEPARLWTSMESKNPR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4049643 | 4049723 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 5537644 | 5537724 | + | NZ_CP054254.1 | Klebsiella variicola |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14849.8 | 1.0 | 2 | 1549.5 | opposite-strand | YidC periplasmic domain |
| 2 | PF02096.22 | 1.0 | 2 | 1549.5 | opposite-strand | 60Kd inner membrane protein |
| 3 | PF12631.9 | 1.0 | 2 | 53.0 | opposite-strand | MnmE helical domain |
| 4 | PF10396.11 | 1.0 | 2 | 53.0 | opposite-strand | GTP-binding protein TrmE N-terminus |
| 5 | PF01926.25 | 1.0 | 2 | 53.0 | opposite-strand | 50S ribosome-binding GTPase |
| 6 | PF13356.8 | 1.0 | 2 | 155.5 | opposite-strand | Arm DNA-binding domain |
| 7 | PF14659.8 | 1.0 | 2 | 155.5 | opposite-strand | Phage integrase, N-terminal SAM-like domain |
| 8 | PF00589.24 | 1.0 | 2 | 410.5 | opposite-strand | Phage integrase family |
++ More..