Result : EXP02162

Protein Information

• Protein name: EXP02162
• NCBI Accession ID: NC_016810.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
• Left: 4030526
• Right: 4030573
• Strand: -
• Nucleotide Sequence: ATGCTGTATATATGCCTTAACGGTTCAGTCATAATCCCTATAAATTGA
• Sequence: MLYICLNGSVIIPIN
• Source of smORF: Transcriptional-level
• Pubmed ID: Venturini et al 2020
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4009225	4009272	-	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	1822465	1822512	-	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF02656.17	1.0	2	2387.5	same-strand	Domain of unknown function (DUF202)
2	PF06826.14	1.0	2	25.0	same-strand	Predicted Permease Membrane Region
3	PF02080.23	1.0	2	25.0	same-strand	TrkA-C domain
4	PF00011.23	1.0	2	435.0	same-strand	Hsp20/alpha crystallin family
5	PF17886.3	1.0	2	166.0	same-strand	HSP20-like domain found in ArsA
6	PF07119.14	1.0	2	1468.5	opposite-strand	Protein of unknown function (DUF1375)
7	PF12566.10	1.0	2	1760.5	same-strand	Protein of unknown function (DUF3748)