ProsmORF-pred
Result : EXP02162
Protein Information
Information Type Description
Protein name EXP02162
NCBI Accession ID NC_016810.1
Organism Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
Left 4030526
Right 4030573
Strand -
Nucleotide Sequence ATGCTGTATATATGCCTTAACGGTTCAGTCATAATCCCTATAAATTGA
Sequence MLYICLNGSVIIPIN
Source of smORF Transcriptional-level
Function
Pubmed ID Venturini et al 2020
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 15
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 2
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 4009225 4009272 - NC_003197.2 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2 1822465 1822512 - NZ_CP053416.1 Salmonella bongori
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_003197.2
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF02656.17 1.0 2 2387.5 same-strand Domain of unknown function (DUF202)
2 PF06826.14 1.0 2 25.0 same-strand Predicted Permease Membrane Region
3 PF02080.23 1.0 2 25.0 same-strand TrkA-C domain
4 PF00011.23 1.0 2 435.0 same-strand Hsp20/alpha crystallin family
5 PF17886.3 1.0 2 166.0 same-strand HSP20-like domain found in ArsA
6 PF07119.14 1.0 2 1468.5 opposite-strand Protein of unknown function (DUF1375)
7 PF12566.10 1.0 2 1760.5 same-strand Protein of unknown function (DUF3748)
++ More..