Result : EXP02159
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02159 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3864522 |
| Right | 3864578 |
| Strand | - |
| Nucleotide Sequence | ATGTGTCTGCTACCCACAAACCTTAATAATAAGACTGACCAGCAAACCAGACGGTAA |
| Sequence | MCLLPTNLNNKTDQQTRR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3843219 | 3843275 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1685092 | 1685151 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02092.19 | 1.0 | 2 | 1368.0 | same-strand | Glycyl-tRNA synthetase beta subunit |
| 2 | PF05746.17 | 1.0 | 2 | 1368.0 | same-strand | DALR anticodon binding domain |
| 3 | PF02091.17 | 1.0 | 2 | 447.0 | same-strand | Glycyl-tRNA synthetase alpha subunit |
| 4 | PF13983.8 | 1.0 | 2 | 6.0 | same-strand | YsaB-like lipoprotein |
| 5 | PF01757.24 | 1.0 | 2 | 103.5 | opposite-strand | Acyltransferase family |
| 6 | PF05360.16 | 1.0 | 2 | 1121.5 | same-strand | yiaA/B two helix domain |
| 7 | PF00370.23 | 1.0 | 2 | 1649.5 | same-strand | FGGY family of carbohydrate kinases, N-terminal domain |
| 8 | PF02782.18 | 1.0 | 2 | 1649.5 | same-strand | FGGY family of carbohydrate kinases, C-terminal domain |
| 9 | PF13377.8 | 1.0 | 2 | 4875.5 | opposite-strand | Periplasmic binding protein-like domain |
| 10 | PF00165.25 | 1.0 | 2 | 4875.5 | opposite-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 11 | PF12833.9 | 1.0 | 2 | 4875.5 | opposite-strand | Helix-turn-helix domain |
++ More..