Result : EXP02158
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02158 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3755123 |
| Right | 3755188 |
| Strand | - |
| Nucleotide Sequence | ATGCTTTCTCTTTTTTGTGTCATTTACCAGGTTATTAATTTTTTAACAACGATAATTACAGTTTGA |
| Sequence | MLSLFCVIYQVINFLTTIITV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3733813 | 3733878 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2380725 | 2380790 | - | NZ_CP033744.1 | Citrobacter freundii |
| 3 | 2693412 | 2693477 | + | NZ_CP044098.1 | Citrobacter portucalensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 3 | 4209 | same-strand | ABC transporter |
| 2 | PF12399.10 | 1.0 | 3 | 3669 | same-strand | Branched-chain amino acid ATP-binding cassette transporter |
| 3 | PF02653.18 | 1.0 | 3 | 1931.5 | same-strand | Branched-chain amino acid transport system / permease component |
| 4 | PF11862.10 | 1.0 | 3 | 2395 | same-strand | Domain of unknown function (DUF3382) |
| 5 | PF13458.8 | 1.0 | 3 | 468.5 | same-strand | Periplasmic binding protein |
| 6 | PF01094.30 | 1.0 | 3 | 468.5 | same-strand | Receptor family ligand binding region |
| 7 | PF13433.8 | 1.0 | 3 | 468.5 | same-strand | Periplasmic binding protein domain |
| 8 | PF12568.10 | 1.0 | 3 | 58 | opposite-strand | Acetyltransferase (GNAT) domain, PanZ |
| 9 | PF04545.18 | 1.0 | 3 | 2061 | same-strand | Sigma-70, region 4 |
| 10 | PF04542.16 | 1.0 | 3 | 2061 | same-strand | Sigma-70 region 2 |
| 11 | PF18075.3 | 1.0 | 3 | 3161 | same-strand | FtsX extracellular domain |
| 12 | PF02687.23 | 1.0 | 3 | 3161 | same-strand | FtsX-like permease family |
++ More..