Result : EXP02157
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02157 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3729759 |
| Right | 3729806 |
| Strand | - |
| Nucleotide Sequence | ATGTTTCATTTTTATCAGGAGTTAAGCAGAGCATTGGCTATTCTTTAA |
| Sequence | MFHFYQELSRALAIL |
| Source of smORF | Transcriptional-level |
| Function | INDUCTION: Expressed at low levels in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSG6 |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3708449 | 3708496 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1544933 | 1544980 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00343.22 | 1.0 | 2 | 7078.0 | same-strand | Carbohydrate phosphorylase |
| 2 | PF08323.13 | 1.0 | 2 | 5625.0 | same-strand | Starch synthase catalytic domain |
| 3 | PF00534.22 | 1.0 | 2 | 5625.0 | same-strand | Glycosyl transferases group 1 |
| 4 | PF13439.8 | 1.0 | 2 | 5625.0 | same-strand | Glycosyltransferase Family 4 |
| 5 | PF00483.25 | 1.0 | 2 | 4330.0 | same-strand | Nucleotidyl transferase |
| 6 | PF18390.3 | 1.0 | 2 | 2339.0 | same-strand | Glycogen debranching enzyme C-terminal domain |
| 7 | PF02922.20 | 1.0 | 2 | 1247.5 | same-strand | Carbohydrate-binding module 48 (Isoamylase N-terminal domain) |
| 8 | PF02806.20 | 1.0 | 2 | 156.0 | same-strand | Alpha amylase, C-terminal all-beta domain |
| 9 | PF02774.20 | 1.0 | 2 | 144.0 | same-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 10 | PF01118.26 | 1.0 | 2 | 144.0 | same-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 11 | PF02447.18 | 1.0 | 2 | 1666.0 | same-strand | GntP family permease |
| 12 | PF03600.18 | 1.0 | 2 | 1666.0 | same-strand | Citrate transporter |
| 13 | PF13726.8 | 1.0 | 2 | 1666.0 | same-strand | Na+-H+ antiporter family |
| 14 | PF01202.24 | 1.0 | 2 | 3003.0 | same-strand | Shikimate kinase |
| 15 | PF13671.8 | 1.0 | 2 | 3003.0 | same-strand | AAA domain |
| 16 | PF13238.8 | 1.0 | 2 | 3003.0 | same-strand | AAA domain |
| 17 | PF00532.23 | 1.0 | 2 | 3674.5 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 18 | PF13377.8 | 1.0 | 2 | 3674.5 | same-strand | Periplasmic binding protein-like domain |
| 19 | PF00356.23 | 1.0 | 2 | 3674.5 | same-strand | Bacterial regulatory proteins, lacI family |
| 20 | PF13407.8 | 1.0 | 2 | 3674.5 | same-strand | Periplasmic binding protein domain |
| 21 | PF02678.18 | 1.0 | 2 | 4826.0 | same-strand | Pirin |
| 22 | PF17954.3 | 1.0 | 2 | 4826.0 | same-strand | Quercetinase C-terminal cupin domain |
| 23 | PF07883.13 | 1.0 | 2 | 4826.0 | same-strand | Cupin domain |
++ More..