Result : EXP02152
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02152 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3237564 |
| Right | 3237617 |
| Strand | - |
| Nucleotide Sequence | GTGGTTTTTTGTGCTGATGGGGTTTTGGCGTTTTTTAGTCATAAGCTAATGTGA |
| Sequence | VVFCADGVLAFFSHKLM |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3216850 | 3216903 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 358125 | 358178 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 3 | 1024328 | 1024381 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00232.20 | 1.0 | 3 | 5602 | opposite-strand | Glycosyl hydrolase family 1 |
| 2 | PF02347.18 | 1.0 | 3 | 1834 | same-strand | Glycine cleavage system P-protein |
| 3 | PF01597.21 | 1.0 | 3 | 1282 | same-strand | Glycine cleavage H-protein |
| 4 | PF01571.23 | 1.0 | 3 | 162 | same-strand | Aminomethyltransferase folate-binding domain |
| 5 | PF08669.13 | 1.0 | 3 | 162 | same-strand | Glycine cleavage T-protein C-terminal barrel domain |
| 6 | PF01494.21 | 1.0 | 3 | 883.5 | same-strand | FAD binding domain |
| 7 | PF00557.26 | 1.0 | 3 | 2723 | same-strand | Metallopeptidase family M24 |
| 8 | PF05195.18 | 1.0 | 3 | 2723 | same-strand | Aminopeptidase P, N-terminal domain |
| 9 | PF03695.15 | 1.0 | 3 | 4066 | same-strand | Uncharacterised protein family (UPF0149) |
| 10 | PF05164.15 | 1.0 | 3 | 4812 | opposite-strand | Cell division protein ZapA |
++ More..