Result : EXP02148
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02148 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 2970218 |
| Right | 2970307 |
| Strand | - |
| Nucleotide Sequence | GTGTATATCTGTATGAACTTTAGGATCTGGAAATATAATCAACAATCGCATACAATACCGCCTGTAATAGTTTTTTGTTTTCTGCGTTAA |
| Sequence | VYICMNFRIWKYNQQSHTIPPVIVFCFLR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2947646 | 2947735 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 772370 | 772447 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01679.19 | 1.0 | 2 | 1817.0 | same-strand | Proteolipid membrane potential modulator |
| 2 | PF01022.22 | 1.0 | 2 | 1335.0 | opposite-strand | Bacterial regulatory protein, arsR family |
| 3 | PF12840.9 | 1.0 | 2 | 1335.0 | opposite-strand | Helix-turn-helix domain |
| 4 | PF13412.8 | 1.0 | 2 | 1335.0 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 5 | PF01047.24 | 1.0 | 2 | 1335.0 | opposite-strand | MarR family |
| 6 | PF00581.22 | 1.0 | 2 | 798.0 | opposite-strand | Rhodanese-like domain |
| 7 | PF00816.23 | 1.0 | 2 | 16.0 | same-strand | H-NS histone family |
| 8 | PF06610.15 | 1.0 | 2 | 598.0 | opposite-strand | L-alanine exporter |
| 9 | PF09400.12 | 1.0 | 2 | 1082.0 | same-strand | Protein of unknown function (DUF2002) |
| 10 | PF19029.2 | 1.0 | 2 | 1594.0 | opposite-strand | DUF883 C-terminal glycine zipper region |
| 11 | PF05957.15 | 1.0 | 2 | 1594.0 | opposite-strand | DUF883 N-terminal domain |
++ More..