Result : EXP02146
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02146 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 2788934 |
| Right | 2788987 |
| Strand | - |
| Nucleotide Sequence | GTGCTAAACAACAATGTGTTTTATTCAATGAGTACAATAGTCGCAAGCTTTTAA |
| Sequence | VLNNNVFYSMSTIVASF |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2788524 | 2788577 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 429193 | 429249 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 3 | 1732285 | 1732341 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 4 | 694052 | 694105 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00588.21 | 1.0 | 4 | 70.5 | same-strand | SpoU rRNA Methylase family |
| 2 | PF08032.14 | 1.0 | 4 | 70.5 | same-strand | RNA 2'-O ribose methyltransferase substrate binding |
| 3 | PF00085.22 | 1.0 | 4 | 79.0 | opposite-strand | Thioredoxin |
| 4 | PF13098.8 | 1.0 | 4 | 79.0 | opposite-strand | Thioredoxin-like domain |
| 5 | PF13717.8 | 0.75 | 3 | 80 | opposite-strand | zinc-ribbon domain |
| 6 | PF13899.8 | 1.0 | 4 | 79.0 | opposite-strand | Thioredoxin-like |
| 7 | PF03942.17 | 1.0 | 4 | 544.5 | opposite-strand | DTW domain |
| 8 | PF13549.8 | 1.0 | 4 | 1301.0 | opposite-strand | ATP-grasp domain |
| 9 | PF13607.8 | 1.0 | 4 | 1301.0 | opposite-strand | Succinyl-CoA ligase like flavodoxin domain |
| 10 | PF13380.8 | 1.0 | 4 | 1301.0 | opposite-strand | CoA binding domain |
| 11 | PF00583.27 | 1.0 | 4 | 1301.0 | opposite-strand | Acetyltransferase (GNAT) family |
| 12 | PF13302.9 | 1.0 | 4 | 1301.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 13 | PF13091.8 | 1.0 | 4 | 4076.0 | opposite-strand | PLD-like domain |
| 14 | PF00614.24 | 1.0 | 4 | 4076.0 | opposite-strand | Phospholipase D Active site motif |
| 15 | PF10043.11 | 1.0 | 4 | 5476.0 | opposite-strand | Predicted periplasmic lipoprotein (DUF2279) |
++ More..